ZFIN ID: ZDB-TSCRIPT-090929-2965
Transcript Name: mest-202
Previous Name: mest-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000014960 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000014960|OTTDARG00000012661|ZDB-GENE-991111-5 mest|OTTDARP00000012711 mest-001 LG_ CR749763.6 Danio rerio protein_coding KNOWN, 1465 bp
TTTTCAGCCTGAGACCTTTGGATCCTTAGCAACCCGACGC
CTGCTCACAGCCAGTTTTAAGGAATGACAGCTGAGTGACA
GACTCTTAATGTCACTCAACAGCACATGTTTCAGCCCATC
AGGATAAACAACCGATTCACACTGCGATAAAGTGCAGAGA
TCGAGAATGTCAGGCGACTCACCTAATGACAGTGAGTGTG
GGTCAGCTCGTCGTGTGAGCAGAGAATGGTGGCTTCACGT
GGGTTTGTTGTGTGTTCCTCTGCTCGCCGTGTATCTGCAC
ATCCCTCCGCCACAGCTGTCACCTGCGCTTAACAGCTGGC
GCACTTCCGGTCACTTCTTCACATTCAGAGGCAATGACAT
CTTCTATAAAGAGTCAGTTGGAGTTGTGGGAAGCTCTGAT
GTCCTTGTGTTGCTTCATGGCTTTCCTACGTCAAGCTATG
ACTGGTATAAGATCTGGGATTCTCTGACGCAGCGCTTCAA
TAGAGTCATCGCCCTTGACTTCCTGGGCTTCGGTTTTTCT
GACAAACCGAGGCCGCACCGGTACTCCATCTTCGAGCAGG
CCAGTGTTGTGGAAGCTCTAGTTGCCCATTTGGGTTTGTC
AGAGCAGAGGATCAACATCCTATCACACGACTACGGAGAC
ACTGTTGCTCTCGAGTTACTGTACAGGAGTGACCACAACA
GAAGCGGACACATCATTGTAAACAGCCTCTGCCTATCAAA
TGGAGGTATATTCCCAGAGACTCATCATCCAAGATTCCTT
CAGAAAGTGCTGAAGGACTCCGGCTTTATTTCACCTGTAC
TCACTCGTCTGATGAACTTCCAGCTTTTCTCCAGAGGAAT
TAAGGAAGTGTTTGGACCGTACACCCAGCCAACAGAAGCA
GAAGTCTGGGACATGTGGACAGGCATTCGCTTTAATGATG
GAAATCTTGTAATGGACAGTCTTTTGCAATACATTAACCA
GAGGCTGAAACACAGAGAACGATGGGTGGGCGCTCTAACT
TCGACTTTAACACCCCTGCACATGATTTATGGACCCCTAG
ATCCAGTTAATCCACATCCGCAGTTTCTGCAGCTTTACCA
GAAACTAGTGCAGAGATCCACAGTATCTGTTCTAGATGAG
CACGTGAGTCATTATCCACAGCTGGAGGATCCCACAGGAT
TCTTTAATGCCTATCTCAGCTTTATCAACTCATTCTAAGC
CGGGGGATGATCGGATCATTCTGAAGCGAGAAATAAAGTG
AAATTATGTTCCAAATAAGGTTGAAAACATACAAACCCAT
TAATATACCGCAAAGTATTTCTGATGCAAGTCATGTGACT
GAATGCATGAAGTATTGCACCAAATGCCCAATCATTGCAA
GTACTTGTTAATGAATTTGCTCATATTGTATGCCATAACT
TGTAAATACATTTGTGTAACAAACATGAATGCTTTTTTTG
GAAATAATAAATAATTCTTATTATA

mest TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA mest-201 (1)    Ensembl 1371
mest-202 1465
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mest-202 Contained in:
[BAC] CH211-285D14 (1)

Genome Resources: Vega_Trans:OTTDART00000014960 (1),  Ensembl_Trans:ENSDART00000125389 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC059471 (1) 1407 nt
GenBank:CN024583 (1) 928 nt
CITATIONS (2)