Transcript

stab1-201

ID
ZDB-TSCRIPT-090929-2796
Name
stab1-201
Previous Names
  • stab1-001
  • stab1l-001
  • ottdart00000014378
  • si:dkeyp-87e7.6-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000014378 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000014378|OTTDARG00000012293|ZDB-GENE-050208-554 stab1|OTTDARP00000012281 stab1-001 LG_none BX649457.15,BX908725.6 Danio rerio protein_coding KNOWN, 9122 bp
TGAACTGTCTAATAAAATGAAGCTCTTTAGTTCTTTTTCA
CTAAGTCCACTTTAATAAGTCTTAAAAGAAACTCTTTGAT
CGTTCAAGTCTCATTTTTTTCCTGAAATTGCATACCACTC
TGCAACAGCTCCAAGGTCAGAGGTTGGATTCCCACAGAAA
AAAATGCCAACTGATAACATATTTTAGATAAACATGCTGG
TAAGTGCCTAAATGCCACTGTTTAGCATTTAGGTGCATAA
ATGTCACAGTAAATCTCACTTTTAGTAACAAGCCGACCTT
AACTCTAACTTTAACCCTAGCACGGCTGGCTCCTAATATT
CATACGTGAAAAAAAAGTACAAATTCTCAATGTACCATCT
TCAAATTCTGCTGAACCCTGCAATCTGGTCAGCTGACGAG
CGTGGACTTCCCAAACCATCATGAAGCCGACGCAGTGGAG
GAAATCCGGTGATTTTCCTGTCAGGAAAAGATGTTTTTCT
CACCCTCTCTCCAGCTTGAAGCCAGTCTGTGGTGGTTGAC
ACCTCTCTCATTGCTCAACATGCAAAGCTCTGAAAGCACA
TGAGCGAGAAGATCAGAAGAGAGTTTTTTTTAGTGTGGAG
ATGTTTGGAAGCGAAACGTCCAGTTGTGTGCAGTGACTGC
AGATTGTGTCTCAGGAAACGCTCTTCTGTTTGTTGTTACA
TGTTTATCTGACTAATTCTCTGGCTTTGAGGGAGTAGACA
TGTCTTATCTTCTCGTTTTGGGACTTACAGTACTGTGGAC
TGCACAGATTCAAGCCGTTGTTAATCGCTGCGATACACCA
GTTATGGTTCTTCACAGAACATCCTGCACATCCTGTGCTG
CTGCCTCTGCCATCGTCTGCCCACGCGGCTCAAAAAAGGT
CACCAAGACTCCTGATTCCTGCAGATATGTGGTAGAAATT
GGCGGTCGCCAGGTAGAGCTGTCTGGTTGTTCTCATACCT
GTCAGCAGGTCACGACAGTCCAGCAGTGCTGTCCAGGCTT
CTGGGGGCCGCTGTGCTTGCCTTGCCCAAGTTGGTCAGGA
AAGATATGCAATGGCTTTGGTACATGCGAGTCTGGACTAT
CAGGAAATGGCACCTGTGTTTGCGAGGAGGGATATGCAGG
ATTTGCATGCCAGAATTGTTTAAATGAGAATGCCTATGGA
AGCCACTGCCTTTCAGAGTGCAGCTGCGTGAATGGAAAGT
GTAACTCGGGTCCAGATGGGGACGGTAAATGTTACTGTCA
GCCACCATATATAGGACCAAAGTGTGATAAAGTTTCTTCA
TCTTGTTCAAGCTGCCCACTCTACTCGTATTGTAAAGGAG
ATGATGACACAAATGCAGTATGCGAATGTCTGCCTGGAAA
CAAATTTGGGCAAGCATGTTTAGATGTGTGTCCAGAGGGC
ACTTGTGGCATAAATGCTAAATGTTTATCTAAAGATGATA
AGTATAATTGCGAGTGTAAAGAGGGATTTGAGGGAGATGG
CAAACACTGCATTCCCATCAACCCCTGCAAGACTAATAAT
GGAGACTGTCCTGTAACTTCCACCACCTGTGAACTCATAA
GCCCAGGAAAGTCTAAATGTGTGTGTTTGCCTGGAATGGA
GTCATCAGATCCATCCAAAGGATGCACACAGAAGTCAGCC
TGCACAGCGAGTTCATGCCACACCAGTGCCCGCTGTGAGA
CCAATGGCGACGGCTCACCAAGATGCCGCTGCGGCTCTCA
GCAGATTGGCGATGGCAGACGTTGCTATGGAAACCTCATG
GAAAGAGTTGTGGAGCTGGACCGAGAGGGCAGTCAGGCAG
GAAACCTCACTGGAAGTGTTCGCTTTTTCGAGCAAGCGTG
TGAGTTTACACTGAGCCAACACGGCCCGTTCACTGCCTTC
ATTCCTGCAGGACAGAATCCGTTCCAAACACTGGCAGGAC
AGTCCTCGAGCAGCATCCTGAACACAGTGTGCAAAAATCA
CCTGATCCTCGGACAGAAACTGTACAGTGTTCTGGAGGGC
AAGGACATGTGGATGTATGGAGGAGAGAAGATCAGATTCA
AAACTAATAAGCACTTTATCCTGATGAGGGATCCAGACGT
GTTGTTTACAATAGTGGAGAGCGACATCCCAGCATCCAAC
GGAATAATTCATATCATCGACAAGCCCTTTACTCTTACTC
ACATTGAGTCATCAAACAACAACATGGAGTTCTCCACAAA
GACCATCAGTGACATTTTCCGGGAGGATGACAGGTTCAAT
CGATTCCTGTCTCTGGTTGATAACTGTGGCGCTCTTTTGC
CCTTCAGAGGTACGGGTCCACTTACTGTGCTTGTTCCAAC
CAACACTGCCATTGACAAATTCAGAGATGGAAGCCTTATG
TACATGCTGAACGATGCCAAACCAAAGCTCCAGACTCTTC
TGAAACACCATATTTTCTCCTTGGCCGCAATCACTGTAGA
CCAGCTCGCCAGCATGTCCGAGATCACAACCATGGCCAAT
GAGATCCTGAGGATCAATGCCTCTGACGATGGGAGAATTT
TTCTGGGAGACAAAGGAATAACTCTTGAAACCAAAGACAT
CATCGCATCTAATGGGATCATTCACCTGATCAATGGAGTT
CTTGTACCTTCATCCATTGTTCCCATAATGCCCCATCGCT
GTGACGTTAACAGTAGCAGGATCTCATTTGGTTCCTGTGT
TCGATGTAGTCATCTCTATGAGACAAAGTGTCCACCTGGA
AGTGTTGAGCTGCCAGGTCGTCATGAAGGCTGTGAGCCAC
TTCCTGATCGCAGATTTTCATACTCGATTTTTGAGGAAGG
CTGTGCGAAATACTGCAATATTACAGAGACGTCACCGCAG
TGTTGCAGAGGTTTCTATGGGCCGGATTGTAAGCCATGTA
TTGGAGGTTTCCAGAACCCATGTTATGGTAAAGGCACTTG
CTTCGATGGCATTAATGGGAACGGCTCCTGTAAATGTGAA
GCAGCGTTTACAGGTGTCGGTTGCCACCTCTGCTCAAACC
CCAAAAAGCACGGAGAAAACTGTGACGAAGACTGCCGCTG
TGTTCATGGAGTGTGTGACAACAGGCCGGGCAGTTCAGGA
GTTTGTCGGAGAGGATCTTGTTTCGAAGGATTTTTAGGGG
AACTTTGTGACCAAACGGCCTCTGTCTGCGATTCAGACGG
AGCCCTCCTGCACTGCCATATTCATGCCATATGTCTCTAT
GTCAAAGGACAAACCACGTGTGTTTGTCAGCCTGGATATG
AAGGAGACGGTTACGCCTGCACTGAATCCAACCCCTGTCT
TCTGCCTCAGAGAGGCGGCTGTGACACCAATGCTGTGTGT
TCATACAATGCAGGAAAGGTGAACTGTGTTTGTATGGAGG
GTTGGACAGGTGATGGAAGTCTGTGTGTGGAGATCAATAA
CTGTCAGCTGGAGAGCCGTGGCGGATGTCATGAAAATGCA
GATTGCACATCAACTGCACCAGGACAGAATGAATGTAGCT
GCAAGAAAGGCTACATGGGAGATGGTATCATCTGTAAAAT
CGTCAACCCCTGTTTGTCAGATAATGGAGGCTGCCATTCT
TTGGCCAAGTGTAAATTGACAAGCCCGGGAACACGTGAAT
GCACATGCCCAAGCGAATTTGAAGGCGATGGACTCTCGTG
TTATGGAAATATGCTTGTGGAGCTCGATGGAAACTCTGAA
TTCTATTATTTTAATCGCTTCCTTCAAAGGCACAAAGTGA
TTGAGACTGACAGCCAGGTCACAGCTTTAGTTCCATCCAA
AGCTGCTTTCAAAAATCTCAGCGATTTAGAGGAGTCTTTT
TGGTTTGATTATTACAGGCTGCCTCACCTTTTACAAGTTC
ATTTTTTAGAGGGCATCTACACCTCTGAAGACTTGAGGCA
GAAAGCTGGTAAAACAGTTCAGACCATAGGAATGACTAAA
TGGGAGGTCCAAAGCAACGGCAGGGAGCTCATGATCAGCA
ATGCGACAATTCTTGTTCCAGATATCAAGGCAATAAATGG
GTGCATTCACATTATAGACACGGTTCTTCGACCCCCTCTG
TCTGATTTCCCTCCACCACCTCCCACTTTGATGAAGTTCC
TCAACAACACGCCAGAATTCAGCCTTTTCAGGCAGGCGGC
ACTGCTTTACAACTTGGAAAACAGCATCCCAACTCGAGAT
TACACCATTTTGATTCCATATGACAGTGCTGTACAGGAGT
ACCTAATTAAAACGAACGCTACACAACTGAGCAAGGAGAT
TGTAAAATATCACGTGATTCTAAGCGAGCAGCTCTTTCCT
GAACACTTGAGCGACAGACTTTTCAAAAACACGTTTTTAG
GAAACGGGACTCAGATCATGTTCTTCGTGGACATCGAAAA
TCAGATAATAGCAAATGACGTCCCCGTAAACATGAGCTAC
ATTGAGACGAGGCACGGCATAGTGTTCGGAATCCCACGAG
TCTTAGACCTCCATAAGAACCACTGCAGTAAAGATGTGAT
TTTGAAAATTACTGGCCGCTGTGGAGATTGTAAAGCTGCA
CCGCAATGTCCCTTCAGTGCCAAACCTACACAGCCAAAGT
TCCCTCAAAATATGAAGAGTAACTGTAAATACAGGACAAG
AGTTGGAAAAAAGAGAAAGACTGTGTCAGGCTGTCTCATG
GACTGTTTGAGAACAACAAAGGACCACTCCTGCTGTCCAG
GATACTTTGGGCATGATTGTGGAAAATGCCCGGGGACTTT
GGATAACTGGTGCTCCAACAACGGTCAATGCGAGGACGGG
CTGCACGGCACTGGCAAATGTCTCTGTAATGAAGGCTTTC
ATGGAACGGCCTGTGAGATGTGTGAACCCGGGAGATACGG
AAAAGACTGCAAGTCAGAATGTCACTGTGAACATGGCAAA
TGTTTGGATGGCTTGGAGGGAAACGGGCAGTGCATTTGTT
TTAAAGGTTGGAAGGGAGTGAAATGCTCTGTTGTGGTAGT
TGATGATGCCTGTGGGGGAGTTTGTGATGTTAATGCTAAC
TGTATTTCGGGAGATTCGGGAACTCCTCCAACTTGTTCCT
GCACAGCTGGTTATAAGGGTAACGGGACTTCTTGTGAAGA
AATTAACCCATGTGCCGAAGACAATGGTGGATGTTCTGTA
AACGCAAACTGTACTAAAACAGCACCCGGTGAAAGGACCT
GCACATGTACAACCAACTACATTGGTGATGGGGTCATATG
TGTCGAAATGGACGCCTGCTTAGTGAACAATGGAGGATGT
GATGAGAATGCCATATGCATGAAGACTGGACCAAACAGGG
TTGCATGTGCATGCAGGCCTGGTTTTATTTCCCAAGGTCA
TCGATGTTTAGCAGTTAATCCTTGTCGAAAGGATAACGGA
GGCTGCAGCGTTAACGCTGTTTGCAGATACCTCGGTGCTG
GGGAACGCAATTGCACATGCTATATTGGCTTTAAAGGGGA
CGGTTTGCAGTGTGCAGGGACTGTCAGTAGAGAGATCAGT
CGCAATCCTGAAGCAATGTGGTTCAGAAATAATTTAGGCG
CATTTCGATTCCGGGATTGGGTCGGTCGAGGCCCTTTTAC
TGTGTTTGTTCCTCATGCAGATTACGTCACAAATTTTTCG
AACCCTCAAGTTGATTCGTGGATCAATTCGAGTCACAGTT
CAGAGCTGCTGCGTTATCACATCGTCAGTTGTGAAGAATT
GCACTTATCAGACCTCAAATCTGTTAAAGAAGTGGTCACC
GCAAATGGATATAAATTACGCTTCAGCGTTAGAGATGGTG
TTGTTTACATTAACGACAATACAAAGATTATCACCAGTGA
TATTGAATGCTCCAATGGAATCCTGCATTACATAGACAAG
GTCCTCATCCCGTACGATATAACCGGCAAAGCAGAAATCA
GCACTAACCTGAACATCACCGCAGCGGCTGAGCAATATGG
CTTCAAAATGTTCGGGAAGCTCCTCCAGGATGCAGGATTG
ATGCATGTGGTGCAGCATCGAGCCTTTTACCCGTTCACCA
TGTTCTGGCCGACAGATGATGTTTTTAACAACCTCACTGA
GGACAGAAAGACTTGGCTGTACAGTGAAGACCATCGAGAC
AAACTACAAGGCTACCTTAAAGCGCACATAGTCCGCGATG
AGAGGATAGCTGCCATTGGTCTTCCTACTGAGAAAAGATT
GCAGACGCTGTTCGGATCAGAAATCACCTTTAGCTGCAAT
AAAGATTTAATTGGTGACATCTTAATCAATGGAAACAATG
CCAGAATTGTAAACAGGAACATGTTGTTCGATTCAGGAAT
CGCTCATGGAATTGATCAGCTTCTGGAGCCACCCAGCATC
GGTGCTCGCTGTGATGACTTCCGAAGCATAGAGATTAAGG
GACGCTGTGGTTCTTGCCTTTCGCCGCCTCTTTGTCCCTA
CGGATCAACAGACATGAACAGAACTAGCATATGCCGACAA
CCTTACAGACCATACCGAATGCCCAATTACTATGGTATGT
ACTCGTACGGTTACGGATACAGGTCCTACAGAGATTTTTT
GGGTTGTGACCGGGTATGCACAAAATTGACGTGGGACACA
AAGTGCTGTAAAAACCACTTCGGAAGAGACTGCCAGGTGT
GTTCTGGTGGTCTGGAGGCGCCGTGTGGAGAGCATGGAGA
CTGTGATGATGGACAGGGCGGCACAGGCGTGTGTAAATGT
CATACAGGATTTACAGGCAAAGGCTGTGAGCTCTGTCTCG
CCAATCACTTTGGGCCAAACTGCACAGCGTGTAATTGTAC
GATCCACGGCAAGTGTGATGAAGGCCTGGACGGTGACGGC
AGCTGTTTTTGTCAGGAGGGATGGATGGGTGAAAGCTGCC
AGACAGCAATCGAAGTCAAGTCGATCTGTTCTCCCGCATG
TGATCTGAATGCAGTTTGTCTTCCTGAAAATCAGTGCGAG
TGTTTGGAGCCCTATGAAGGAAATGGCATCAACTGCACAG
CTCCGGATCTTTGCAGTGAATATAACGGAGGTTGCCATGA
AGAAGCCGACTGTATGCAGTCAGGTATCAACATTACCTGT
TCCTGTCAGACGGGATACTCCGGAGACGGACATGTTTGCG
AGCCTATTAACCGATGTGTAGAGGAGGCAAATGGCGGCTG
CAGCGATTTCGCAAAATGTATTTTCACCGGACCCAACGAG
CGGCGCTGTCAGTGTCTCGATGGCTATGTGGGAAATGGAG
TCCAGTGTTTGGAGAAAGTGGTTCCTCCTGTTGATCGATG
CCTGGAGGATAACGGCGGCTGCGACCCAAAGGCGATATGC
AGAGACCTTCATTTCCACACGAAAACTGCAGGTGTTTTCC
ATCTGCGCTCACCTGAGGGAAAGTATAAAATGAACTTCAC
GCAAGCAAAGCAGGCTTGTGAAGCAGAGGGAGCCAATCTT
GCCACGTTTTCCCAGCTCTCTGATGCCCAACAGTTAGGAA
TGCACCTGTGTGTGGCCGGATGGATGGACGGGGAGAAAGC
AGGCTATCCGATCCGCTTTCCTTCAGCTAAATGCGGTGAT
AATCATGTCGGTATTGTGGTGTACAAAGATCCAGTCAACT
CCAGTTGGCTGTACGATGCGTACTGCTACAGGATGAATGA
GGTGGCTTGTGAATGTGGAGCTGGATATGTTGGGAGCGGG
GCATTTTGTAATGGAGACTTGGCTTCGGTTGTTGCCACAA
CTTCCAATTTTTCTGTGTTTTACACGAATTTACTGAAGTA
CGCAGAGGATGGAGAGGACGGCAAGACCCTGCTGAAGGCC
CTGTCTGACAAATCATTAAACATGACCATTTTTATACCCC
AGAACAACGGATTTGGAGCAAACAAGACTTTATCGTGGAG
AGATTTGCAGTATCATATCTCCAGCGTCAACAATATTCAC
TATTATGAGAACCTGAAGCACAACACTGCAATCCCGTCTC
GCTTGGGCTCCAAACTCATCATAACCATTCCCTCCAATTC
CAGCGGTCAGACTGAGGACGCTCAACCTCAGAAGCTGGTG
AATAAGAAGGTTATTTTGGCCTGGAACATTCCCGCCATCA
ATGGACTGATCCACGTCATTGATGGGCCTTTCAGAGCTCC
ACCTGTTCCGGTTCCAGCAGTTCTTCCGATCACGCAGTCC
AGCGGTGTTGCAGTGACCACTGTGCTGGTTGTCATAGCGA
TTGTTTGTATTGTTGCTGGACTGGCGTACTATGTCCTCAG
GCACAAGAACGACGCCTTTCGTTTCCAGTATTTTAAAAAT
GATGATGAAGATGGGGCTTCTACAAAAGCTGGTGGAAACG
CATTAGTATCCATCCCAAACCCTCTCTACAGCGGCTACAG
GGCGTTTGCGGAACCATTTGGGGATTCAGCAGCTACAGAC
ACACCCAACCTCATCGACTAGCACAGACAGCAGCGTTAAA
CTCTCCCTTCATTTACCTGCAATCAGCTGACCGCTCTTAA
AATAAAGGTTCTGTATTGGCATTGATGGTTCCGCGAAGAA
TCTTTATAAGCCATAACATCTTTCCATTTCCATGAGGTGT
AAAAAGACTCTTTAGAATATTAAAATGTTACTTCATAAAC
ATTTGATGTGTTTGATTGCAGATACTTCAGAGTGTTTAAC
TTCCACCCATTTATTTCTGCGTTTCACACATATTTTTGAC
TAAAAATGTTCTTTACATTAAGAAAAAATGGTGTACTCAC
CCTCAAGTAGGTCCAAACCTTCACGAGTTTCTTTTTTTGC
CTTCTGTTGAACACAAACAAGAAAATATTTTGATAATGCG
TTAAGCAAGGGGCCATTAGCTGTTTTGATCCAACTTTTTT
CATGCGCATTTTAAATTATCGCATGTAAAAAAGCTTAATG
GAAACCCAAGATGTGCTTAATTTGTCAAAATCTGCATAAA
AACAATGATGAAACAAATTTGCTGATTACTATTCAGCATA
CACATAAAGAAGTCCAGTGATTTTGTTTTAACAGTTTATT
TGATAATAAGAATAGTTTTGTGTTAGAACCGGTGCATTAT
AGAACGGCGTTAATTGATGAACTTAGGAAAAAATCTGAAA
TGATCATTCTAAAGTGGTTAGGTATTATTCAGTGTGCGAA
TTATACATTGATGATTGGGGGGTCAACTTTTTCAGTAATG
TT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations