ZFIN ID: ZDB-TSCRIPT-090929-2756
Transcript Name: iqsec3b-201
Previous Names: iqsec3b-001, si:ch211-11f8.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000014212 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000014212|OTTDARG00000012172|ZDB-GENE-050420-210 iqsec3b|OTTDARP00000012148 CH211-11F8.2-001 LG_ AL928990.4 Danio rerio protein_coding NOVEL, 2502 bp
ATAGAGGAGCTGGAGCAGAAGTATGGTGGTCCTCTAATTT
CCCGGCGAGCAGCCTGTAAGATCCAGACAGCGTTTCGTCA
GTATCAGCTCAGCAAAAACTTCCAGAAGATCCGCAACTCA
GTTCTGGAGAGTGGGATCCCACGACGCATGTCGGTGCGCA
GGGTCCGGGTTCAGCGGGATGGTTTCTCTGCGGAACGTGC
GCTGATGGAGGGATGTTCAATCATGGGCATCCCGCTCACA
CACTCCACCTCACTGCCAGTGACCACCACCACCACACTCA
CACACCTGGAGGACACGTTCAGTGAGCAGGTCCAGTCTTT
AGCGCGGTCTATTGATGAGGCTCTGAGCAGCTGGAGCACC
ATTCGAGATGGGGAAGGAGAGAAGTCTTCTGCTGCCCCTC
CCTCCGGATCCCATCCCGAAGGGCTCCTGATGGACCCCTC
CAGCCTACAGGAGGCCACACAGAGTGGCTGTGGCGAGAGC
ATACCTCGCAGTGCCAGCAAACTCATGATGGCTTTCAGGG
ACGTCACTGTTCAAATCGATAATCACAACTTTCGCCTGTC
CTCCTCCATGCTGGAGTCAGTTTCTCTTGGTAACGGCGTG
GCAAAAGAAACTGTCTCAGAGCCCCAAATTGGGGGACAAA
TTGCAGGCCAGACAACGCTGTCGACCGCAGGGGACCCTGA
ATTTCCTCCTCCTCCACCCAGCGAGGAAGAAAAAGAGAAC
CAACAGCCAATTGGATTGGACACAGTGACCACAGGAGCGG
GGCTGGAGGGGAAACAGACCAATCAGGTTGCACCGGAGAT
AGCGGAGAACAGCTCAGACCCCATCAGCAGCAGCAGCACC
TCCACATCAGCATGTGAGACTATGATCCTGTCTCTGCCTC
GCCCACACTGCCAGAACACACCCTGCGGGACGCTCTCCAC
AGACATTGCACGCAAACGGCTGTACCGCATCGGACTTAAC
CTCTTTAATGTAAATCCAGACAAAGGCATCCAGTTCCTGA
TTTCCAGGGGCTTTATTCCGGACACAGCCATCGGTGTGGC
TCATTTTCTGCTTCAGAGGAAAGGACTGAGCCGGCAGATG
ATCGGGGAGTTTCTGGGAAACAGCAAAAGGCAATTTAACA
GAGACGTGTTGGACTGTGTGGTGGATGAGATGGATTTCTC
CATGCTGGAGCTGGACGAAGCGCTCAGGAAGTTTCAGGCT
CATGTTCGGGTTCAAGGAGAAGCTCAGAAAGTGGAGAGAC
TTATTGAAGCCTTCAGTCAGAGGTATTGCATGTGTAACCC
AGACGTGGTGCAGCAGTTTCACAACCCCGACACCATCTTC
ATCCTGGCCTTCGCCATCGTGTTGCTCAACACAGACATGT
ACAGTCCCAACATCAAACCAGAGCGCAAGATGCTTCTGGA
GGACTTCATCCGCAACCTACGAGGAGTGGACGATGGAGCA
GATATTCCACGGGAGATGCTGGCTGGGATTTATGAGCGGA
TTCAGCAGCGGGAGCTTCGATCCAATGAGGACCATGTGAC
CTACGTTACCAGGGTGGAGCAGAGCATTCTGGGAATGAAG
ACGATCCTGTCGGTTCCTCACCGCAGGCTGGTGTGCTGCA
GTCGACTCTATGAGGTCACGGATGTAAATAAACCGCAGAA
ACAGGCTTCACATCAGAGGGAGGTTTTCCTCTTCAATGAC
CTGATAGTGATCCTAAAACTGTGCCCTAAGAAGAAGACTG
CCGCCACATATACGTTCTGCAAGGCCATGGGTTTACTGGG
AATGCAGTTTCACCTGTTTGAGAACGAGTATTATCCTCAT
GGAATCACGATATTGTCTCCGTTCTCGTCGGAGAAGAAGC
AGGTGGTGAGTTTCTGTTCTCAGAGCGCCGACGAGCTGCT
CAAGTTCATAGAGGACCTGAGAGAGAGCATCGCAGAAGTG
GCAGAGATGGAGCAAATCCGCATTGAGTGGGAACTAGAAA
GACAACAGGTTGTGAGAAATCAAACTAACAAGAACGGCAC
ACAACTGGACATCCATGCCGGACCGAGTTCTGCTTCAGGG
GATGATTTTTATGAGAAAGCGGGAAGCAACACGGTAGAGG
TGTCAATTCACAACAGGCTCCAAACGTACCAACTCAGCTC
TCCTCTGGCCCCGCCCAGCGCTCAGCAACGCCTGGCCGTC
CTGCCTAGCCCCGCCCCTGACTCCGCCCTCACCATCTCCC
CCGACACCCTGATCCAGTGCCAGCAGATCGTCAAGGTGAT
TGTCGTGGATTCGGCTGGGCGTGGCCATGTGGAGGCGTTT
CTCAGCCACAACCCCGCTCATCGCCTCATCCAATCAGCGG
TGTCCACGCCCACTAGGTCCCGGGAGGCGGGAAAACAACA
ACAGCAGCAGCAGCAGCCGCCCCTTCCCCCTCCACCGCCT
CCTTATCATCACCCACATCAGTTTTGCCCGCCGACTCCAC
CTCCGCCACGCCACCTGCTGAGCCAGCGCAGGTACTCCAG
CGGGACGCGCAGCCTAGTCTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
iqsec3b-201 Contained in:
[BAC] CH211-11F8 (1)

Genome Resources: Vega_Trans:OTTDART00000014212 (1),  Ensembl_Trans:ENSDART00000137037 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CD755072 (1) 779 nt
CITATIONS (2)