Transcript

znf1178-201

ID
ZDB-TSCRIPT-090929-2728
Name
znf1178-201
Previous Names
  • znf1178-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000014129 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000014129|OTTDARG00000012105|ZDB-GENE-050208-466 si:dkey-1b17.12|OTTDARP00000012074 DKEY-1B17.12-001 LG_ BX649416.15 Danio rerio protein_coding NOVEL, 951 bp
AGTGAGAAGATGAGTGATCCAGAACCCTGCAGAATTAAAC
AGGAAGAGACTGAAGAACTAATAGATGTGATGGTGAAGGA
GGAGAGCGAAGAACTGAGTGAAGATGAGGAGAAACATCAT
GTCAAAACTGAAACAATATCTCACACAAAAACCGAACAAA
GTTTTTTAATGGAAAGAGCAGCTGAGAATGGTTTCATCTG
CACTCAGTGTGGAAAGAGTTACAGCCGCAAATGCGCTCTC
AAGCTTCACATGAGGATCCACACCGGAGAGAAACCCTTCA
AGTGTTCGCACTGCGACATGAGCTTCTTTTGTTCGGGATA
TCTGAAAACACACGAGATGACCCACACTGGAGAGAGACCG
TTCGTGTGCGCGCAGTGTGGGAAGAGTTATAGCCACAAAA
ACAACCTCAAGCTTCACATGAGGATCCACACTGGGGAGAA
ACCATTCAAGTGTTCACACTGTGAGAGGAGGTTTAGTAAT
GCAGGACACCTGAAACATCACAGAATGATTCACACAGGGG
AGAAACCGTTCACATGTGCTCAGTGTGGAAAGAGTTTCAC
ACGGCAGTCGTGTTTAGCACAGCATCAGCAGATCCACACT
GGGGTGAGTAAGCATGTCTGCTTAATGTGTCAGAAGACTT
TTATTAGAGCTGGGAACTTGAGACAACACCAGATGACGCA
CACTGGAGAGAAACCGTACACGTGTTCACACTGCGACAAG
AGCTTCAGCCAGTTTAAAGTGCTGAAAATACATCAGAGGA
CTCACACTGGAGAGAAACCGTTCACATGTACTCAGTGTGG
GAAGAGCTTCACACAATCTTCACACCTTAATCGACACATG
CTGATCCACACCGGAGAGAAAACGCACATATGTGATCAGT
GCAGCAAGACATTTTTGAGGCCTTGCGAGCTGAAGAGACA
TCTTAAAGTTCATACAAAGAAATCTTACTCT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations