Transcript

si:dkey-1b17.6-202

ID
ZDB-TSCRIPT-090929-2720
Name
si:dkey-1b17.6-202
Previous Names
  • si:dkey-1b17.6-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000014121 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000014121|OTTDARG00000012098|ZDB-GENE-050208-384 si:dkey-1b17.6|OTTDARP00000012069 DKEY-1B17.6-001 LG_ BX649416.15 Danio rerio protein_coding NOVEL, 858 bp
GACGCGTTCATTCAGCGTCGAGTCTTCAGAGCTGAGCTCT
GCCGCCATCAGTGAAAGACAAAGACAGAGTTTATTGAAGG
ACAGTGAGAAGATGAGTGATCCAGAACCCTGCAGAATTAA
ACAGGAAGAGACTGAAGGACTAATAGAAGTGATTGTGAAG
GAGGAAAGTGAAGAACTGAGTGAAGACGAGGAGAAACATC
ATGTCAAAAGTGAAAGTGAAACTCACTCAAATACTAAAAA
TTTTTCAATGGACAGAACAGCCGTTAAATGTTTCACCTGC
AGTTTATGTGGAAAGAGTTTCTTGCGCAAATGCAGTCTCA
AGATTCACATGAGGATCCACACTGGAGAGAAACCTTACAA
GTGCTCACACTGCGACAAGAGATTCAGTGATTCAGGAAAC
CTGAAAACACACGAGAGGATTCACACTGGCGAGAAACCGT
ATCACTGCACTGATTGTGGAAAGAATTTCACAAATTCAAC
TTCTCTACGATCGCACAGAAAACACAATCACAATGTGATG
GTGAAGGAGGAGAGAGAAGAACTGAGTGAAGATGAGGAGA
AACATCATGTCGAAAGTGAAAGTGAAACTCGCACGAACAC
AGAACACAGTTTTTTAAGAACAGCCTTGAACGGTTTGACC
TGCACTCAGTGTGGAAAGAGTTTCAGCCGCAGACACAATC
TCAAGCTTCACATGAGAACTCACACTGGAGAGAGACCTTA
CAAGTGCTCACACTGCGACAACAGATTCAGTAAGTCGGGA
AACCTGAAAACACACGAGAGGATTCACACTGGAGAGAAAC
CGCATCACTGCACTGCTTGTGGGAAGAGTTTCACAGATTC
ATCTTCTCTACGATCACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations