Transcript

znf1184-201

ID
ZDB-TSCRIPT-090929-2713
Name
znf1184-201
Previous Names
  • znf1184-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000014114 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000014114|OTTDARG00000012091|ZDB-GENE-050208-784 si:dkey-15h8.3|OTTDARP00000012063 DKEY-15H8.3-001 LG_ BX640576.8 Danio rerio protein_coding NOVEL, 1248 bp
CCCCATCAGTGAAAGACAAAGACAGAGTTTATTGAAGGAC
AGTGAGAAGATGAGTGATCCAGAACCCTGCAGAATTAAAC
AGGAAGAGACTGAAGAACTAATAGATGTGATGGTGAAGGA
GGAGAGTGAAGAACTGAGTGAAGATGAGGAGAAACATCAT
GTCAAAACTGAAACCAAAACTGAATCAAAGACTGAACACA
GTGTTTTCATGGAAAGAACGGCTGTGAAAGGTTTGACCTG
CACTGAATGCGGAAAGAGTTTAAGCTCTCAATTTGATCTC
AAGCATCACATGATGATCCACGCTGGAGAGAAACCACACA
AATGTGATCAGTGCAGCAAAACATTTTTGAGGCCTTCAGA
GCTGAAGAGACATCTTGGCGTTCATTCAACGGAGAGGCCT
TATTCATGCCCTGAGTGTGGAAAGAGTTTTAGACGACGGA
CCGATTTATCACTACACAAGAAAATCCACACAGCAGTGAG
AGAGTTTGTGTGCTCTGAGTGTAAGAAGACGTTTACTAGA
CCTGAATACTTGAAAATACACGAGAGCATTCACACTGGAG
AGAAACCTTTTGAGTGTTCACACTGCAACAAGAGATTCCG
ACTGGCTGGGATCCTTAAATATCACAAAATGATTCACACT
GGAGAGAAACCGTTCACATGTACTCAGTGTGGGAAAGGTT
TCACACAAGTATCAAACCTTAATGAACACATGATGCTCCA
CACTGGAGAGAGACCACACAAATGCGATCACTGCGGTAAA
ACGTTTTCGAGGCCTGCAGACCTGAAGAGACATCTTATAG
GTCATACAAAGGAGAAGCCTTATTCATGTTCTGAGTGTGG
GAAGAGTTTTGCACAGAAGTCACATTTAAAAGGCCATCAG
AAGATCCACACTGGCGTGAGAGAGTTTGTCTGCTCTGACT
GTGGGAAGAGCTTTATGAAAGCTACAGACTTGAGACGACA
CCAGCTGATTCACACTGGAGAGAAGCCGTACGTGTGTTCA
CACTGCAACAAAGCATTCAGAGATTCAGGATACCTGAAAG
CACATGAGAGGATTCACACTGGAGAGAAACCGTTCACTTG
TACTCAGTGTGGGAGGAGTTTCACACGATCTTCCACTCTT
TCTGAACACATACTGACGCACACTGGAGAGAGAAAACACA
AATGCGATCACTGCAGCAAAGTATTTTTGAGAATTTCAGA
GCTGAAGAGACATCTTAGACTTCATACACAGGTGAAGCCT
TATTCATG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations