ZFIN ID: ZDB-TSCRIPT-090929-2712
Transcript Name: znf1168-201
Previous Name: znf1168-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000014113 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000014113|OTTDARG00000012090|ZDB-GENE-050208-703 si:dkey-15h8.2|OTTDARP00000012062 DKEY-15H8.2-001 LG_ BX640576.8 Danio rerio protein_coding NOVEL, 961 bp
CTCTGCCGCCATCAGTGAAAGACAAAGACAGAGTTTATTG
AAGGACAGTGAGAAGATGAGTGATCCAGAACCCTGCAGAA
TTAAACAGGAAGAGACTGAAGAAAAAATAGATGTGATGGT
GAACAGTGAAGAACTGAGTAAAGATGAGGAGAAACATCAT
GTCAGAAGTGAAACCCAAACTCAGTCAAAGACTGTACGTA
GTTTTTCAATGAAGAGGACAGCCGTGAAATGTTTCACCTG
CACTCTGTGTGGAAAGGGTTTCAGTTATAATCGCCCTTTC
AAGCTTCACATGATGATCCACACTGGAGAGAGACCGTACA
AGTGTTCACACTGCGACAAAAGATTCAGTCAGTTTGGACA
CTTGAAATCACACGAGATGATCCACACTGGAGAGAAACCG
TACACGTGTGATCAATGCAGCAACACATTCCTGAGGCCTT
CAGACTTGAAGATCCATCTTAGAGTTCATACAAACGAGAA
ACCTTACTCATGCCCTGAGTGTGGAAAGCGTTTTGCACAG
CACGCACATCTAAAACTGCATCAGCATGTCCACACTGGTG
TCAGAGAGTTTGTGTGCTTTGAGTGTGAGAAGACTTTTAT
TACAGCTGGACACTTGAAGCAGCACCAGATGATCCACACA
GGAGAGAAACCGTACACGTGTTCACACTGCAGCAAAACAT
TCAGTCATATAGGACACATGAACGCACATGAGCGGGTTCA
CACTGGAGAGAAACCGTTCGCATGCACTCATTGTGGGAAG
AGTTTCAGAGTTTCATCCTCCCTGAATTCACACATGCTGA
CGCACACTGGAGAGAAAACGCACAAGTGTGATCAGTGTGG
CAAATCGTTTTTGAGGCGTTCACATCTGAACAGACATCGT
AGTGTTCATACGAAAGAAAAGCCTCCTTCTTGTTCATTAA
GAAAGAGTTTTAGACGTTGATTAACTTTTATCTTCCAACC
A

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
znf1168-201 Contained in:
[BAC] DKEY-15H8 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000014113 (1),  Ensembl_Trans:ENSDART00000158966 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CO805679 (1) 842 nt
CITATIONS (2)