ZFIN ID: ZDB-TSCRIPT-090929-2701
Transcript Name: fam32a-201
Previous Names: fam32a-001, fam32al-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000014040 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000014040|OTTDARG00000012024|ZDB-GENE-040704-44 fam32a|OTTDARP00000011998 DKEYP-70F9.4-001 LG_ BX323550.13 Danio rerio protein_coding NOVEL, 983 bp
AAAATAAGGCCATGCTTGCTCAATTCTCACATGTGACTGT
TTTAATAAAGCTTTTCCAAAGTACATAACACGGGCAGCGT
ATGAATTTATAACAAACGACTGGTTGGAAAAAGCAACTAA
GCAGAAATAAATCGTTGTTTAAGAAACGAGTTTACTCCTG
TTCTCTAGAGGGCAGTAAATCCGAGGAAAATTGATAAACA
ATCCTGTTGGGACGCAAGCTAGTCTGATACAGACAGAAGC
TGAAATGTCGGAGTACAAGTCTGTCCAGAAAGGCTCTTTA
AAACTGAAAGGGGTTTCTTTACCAAGTAAAAAGAAAAAGA
AGAAGAATAAGGAAATGAAGCGTTTGGAGGAACAAGTTTT
GACCTCTGAAAACGAAGAAGGAACTAAAAAAGCTTATGTT
GACAAAAGGACACCAGCACAGATGGCATTCGACAAAATAC
AAGAGAAAAGGCAAATGGAAAGAATCTTGAAGAAAGCCTC
CAAAACACACAAGAGAAGAGTTGAGGATTTCAACAGACAC
CTGGACACACTGACAGAGCATTATGACATTCCTAAAGTCA
GCTGGACGAAATAAATATTTGTGGATTTTCAGTTTCATGC
TTCAATAGCATATGGGCTTGTTTTTGTTTTCTTGTAATTA
GTGCTGCAGCAAAGTCCAGAGTGATTTTAAGTTTTCATTT
AAAATTTTAAACCCTTTTGGATGCAGTCAACCTCTTTCTT
TCTTTTTCTTTTCTTTTCTTTTTTAACACATTCAAGGTTC
AAATGTTTGTGAAAATTACATTTTGTAACTTGTGGTTCAA
TTATGTATTTATGCTGTTGATTGGCTTTTGTTTATTGCAA
GGCTTGACTGCCAAAAAAATAGTCCAAACATGTAAAGTGG
CTTCAATTGCAATTTATGACAGAAAATGTTGATTCAAGAG
TGATGCTTTGTTACATTTGTGCATGTGACTGTATAAGTTT
CCTTAATAAAATTCATTTAAGCC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fam32a-201 Contained in:
[BAC] DKEYP-70F9 (1)

Genome Resources: Vega_Trans:OTTDART00000014040 (1),  Ensembl_Trans:ENSDART00000128149 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH537804 (1) 1001 nt
GenBank:CK019336 (1) 909 nt
GenBank:CK353537 (1) 836 nt
GenBank:CK397979 (1) 811 nt
GenBank:CK397992 (1) 771 nt
GenBank:CK400731 (1) 764 nt
GenBank:AL730867 (1) 659 nt
GenBank:BI886724 (1) 591 nt
GenBank:AI722693 (1) 582 nt
GenBank:AL730919 (1) 576 nt
GenBank:BI671775 (1) 570 nt
GenBank:CB363140 (1) 553 nt
GenBank:AI721638 (1) 544 nt
GenBank:AW595106 (1) 471 nt
GenBank:BI840029 (1) 418 nt
CITATIONS (2)