Transcript

celsr1a-202

ID
ZDB-TSCRIPT-090929-27
Name
celsr1a-202
Previous Names
  • celsr1a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000001946 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000001946|OTTDARG00000001824|ZDB-GENE-030616-78 celsr1a|OTTDARP00000001722 RP71-6L08.1-001 LG_none AL645790.8,CU855579.12 Danio rerio protein_coding KNOWN, 9089 bp
AGAATAAAGCGAGCCGCGAATTCAGTGCCTCAGTTTCAGT
TATCGAACTACCAGGTTTCAGTGCCCGAAAACGAGCCTGC
GGGGACGCGCGTCATCACTCTCAAAGCGACTGTCAGCGAC
CCCGGTGAAACTGGAAAGATTGAGTATGGAATGGAAGCGC
TTTTCGACAGCCGTTCTAACGATTTCTTTCGAATAGACCC
TCAAACTGGCAGCATCGAGACTGCCCAGCCCTTAGACAGA
GAAGTTAAAGACACTCATGTGTTTAAAGTTACAGCTTCTG
TTGCAGGTTTTGCCAAACGTGCAGCCACTTCGTACCTCAC
AATAACAGTGAGTGACACCAACGACCACGGGCCCGTTTTT
GAGCAGAACGAATACAGGGTGAGGATACGAGAAAACGTGG
AAGTTGGTTTTGAGGTCATTACGGTCAGGGCAACAGATGG
GGACGCTCCATCCAATGCAAACATGATATATAGGATTATG
AACGAGGAAGGTGTTAATTCTGGGTTTGAAATTGATTCTT
GGAATGGACTGGTCAAGATTAAGGTGCGTCCAGACAGAGA
AACTATGGCCCAGTATCAGCTGATTGTAGAGGCCAGTGAC
CAAGGTAAGGAACCTGGGCCCCGCAGTGCTACTGCGACAG
TTCACATCACCGTTGAAGATGAAAATGACAACTATCCTCA
ATTTAGTGAGAAAAGATATGTGGTCCAGGTGCCTGAAAAC
GTGGCCGTTAACACTAAAGTAGCCCAGGTAGAAGCCACAG
ATCGAGATGAAGGCAATAATGCTAGGGTCCATTACAGTAT
AATCAGTGGCAATGTAAAAGGTCAGTTTTTTATCCACACT
CCCACTGGAGCCATTGATGTCATAAACCCTTTGGACTACG
AAACAATCAGAGAGTATAATTTACGCATAAAGGCCCAGGA
TGGGGGCAGGCCTCCTCTCATTAACGGCACAGGAGTCGTT
GTGGTTCAAGTAGTGGATGTCAATGACAATGCTCCCATGT
TCGTAAGCACTCCTTTCCAAGCAACCGTTTTAGAGAATGT
CCCCATTGGATATTCTGTCATTCACATTCAGGCCATTGAT
TCGGATTCAGGCGAAAATGCCCGGTTAGATTACAGCCTCA
CAGACACCACTCCAGGCTTCCCTTTCAGTATCAACAACAG
CACTGGATGGATAACTGTGAGTGATGAGCTGGACAGGGAA
AGCACTGAGTTTTACACCTTTGGAGTGGAGGCCAGAGATA
ATGGAGTTCCAGTGATGTCATCCTCAGCAAGCGTTAGCAT
CACTGTCCTAGATGTGAACGACAATATCCCTACGTTCACT
GAGAAGATGTATTCCCTGAAAATCAACGAAGATGCTGTTG
TCGGGACAAGTGTGTTAACTGTTACAGCTCTGGACCGTGA
TGTGAACAGTGTAGTCACTTATCAGATCTCCAGTGGCAAT
ACACGCAACAGGTTTGCCATCACTAGCCAAAGTGGAGGTG
GACTCATCACACTTGCATTGCCGTTAGATTACAAGCAAGA
ACGACAATACGTTTTGACCATCACCGCCTCTGACGGCACA
CGATTTGACACCGCACAAGTGTTCATCAACGTAACCGATG
CTAACACTCACAGACCCGTGTTCCAAAACGCCAACTACCA
TCAAACCTTCAGCGAGGACCAACCCATCGGATCAACTGTT
GTGGTCATCAGTGCCACAGATGAGGATACAGGAGAGAATG
CACGTATCACCTACATCATGGAGGACAACGTCCCACAGTT
TAAGATCGATCCAGACTCGGGCGCCATCACAACACAGATG
GAGATCGACTACGAAGATCAAGCCTCCTACACATTAGCCA
TCATAGCCCGTGACAATGGCATTCCTCAGAAGTCCGACAC
CACCTATGTGGAAATCATCATTCTGGATGCCAATGACAAT
TCTCCGCGGTTTGGAAGGGACAAATATCAGGGCACCGTGT
TTGAAGATGCCCCTATATACACCAGCGTGCTCCAAATATC
AGCTTCTGACAGGGACTCAGGGTCTAATGGACGTGTGAGC
TACACCTTTCAAGGTGGCGATGATGGAGAAGGAGACTTCA
TGATTGAGCAATACTCCGGGATCATCAGAACCCACCGGAA
ACTGGACAGAGAGAACGTTCCAGTGTATAACCTGAGGGCC
TATGCTGTAGACAGAGGAGTTCCTCCTCTCAAAGCTGCGG
TGGAGATCCAGGTTTCCGTACTGGACATCAATGACAATGC
ACCTGTGTTTGAAAAGGATGAACTTTATATCGATGTCAAG
GAAAACAGTCCTGTAGATTCAGTGGTTGCCCGAATTACTG
CTATGGACCCGGATGAAGGAACCAACGCTCAGATATTATA
CCAGATTGTTGAAGGAAACATCCCTGAGGTTTTTGACTTG
GATATATTCACCGGAGACTTAAAAGCGCTTGTGGATTTGG
ACTACGAGACCCAAAAGGAGTATGTCATTGTCGTACAGGC
TACATCTGCACCTCTGGTGAGCAGAGCAACGGTCCACGTT
CGTTTGATCGACGTCAACGATAACGATCCCGTCCTGCAGA
ATTTCGAGATTATTTTTAATAACTACGTCACCAACAAATC
CAACAGCTTTCCATCTGGGATTATAGGAAAGGTGCCTGCC
CATGACCCAGACGTGTCAGATAAACTCAAGTATAGTTTCA
TTGAAGGAAATGAGCTGAGTTTGCTGATTCTAAACCCTGA
CACAGGAGAGCTAAAACTCAGCAAAGATCTGGATAACAAC
AGACCTCTGGAGGCCACCATGAAGGTTTCTGTCACAGATG
GGATCCACCAAGTCACTGCCTTCTGTACTCTCCGTGTCAC
CATCATCACTGATGAGATGCTAACAAACAGCATCACAGTC
CGTCTGGAGAACATGTCCCAGGAACGCTTCCTATCCCCAC
TACTCTCCTTGTTCGTCAAAGGTGTAGCAGCTGTCCTCTC
AACTAGTCGCGAAGGAGTTTTCATCTTCAATGTCCAGAAC
GACACGGACGTCAGTGGAAACATCCTCAATGTCACCTTCT
CCGCCTTGCTCCCAGGAGGAGTTCCGGATCGCTACTTTCC
TTCGGAGGAGCTTCAGGAGCAGATCTACCTGAACCGTACT
CTGTTACAGGAAATCTCCAGCCAAAACGTCCTACCATTCG
ATGACAACATCTGCCTAAGGGAACCTTGCGAGAACTACAT
GAAATGCGTCTCTGTATTAAAGTTCGACAGCTCTCCACCT
TTCATAGCTTCTGATACTGTTCTCTTCAGACCAATACATC
CTATTAATGGTCTTCGCTGCCGTTGTGAGAACTGTGAAGT
AGACAGCCGCTCTGGTCGTTGTGTTCCCGGGGTGTGTAAA
AACGGAGGCGAGTGTGTCAACCTGCTAGTCGGCGGCTTCA
CATGCAACTGCCCTTCAGGAGAGTACGAGAAACCCTTCTG
TGAGATGACGACCCGCAGCTTTCCCGGACAGTCCTTCATC
ACTTTCCGAGGCCTAAGACAGAGATTCCACTTCACAGTCT
CCTTCATGTTTGCTACGAGAGAGAGAAACGCCCTTCTGCT
CTACAATGGTCGCTTCAATGAGAAACATGACTTCATAGCT
GTGGAGATCATCGAGGAGCAAATTCAACTCACCTTCTCAG
CAGGGGAGTCTAAAACAACCGTTGCACCTTTCGTACCTGG
TGGAGTTAGCGATGGCCAGTGGCATTCAGTTCAGCTTCAT
TACTACAATAAGCCCAAGATCAGTCATTTGGGGTTGCCTC
AAGGTCCGTCAGGTGAAAAGGTGGCAGTGGTTGCTGTAGA
TGACTGTGACATTGCCATGGCAGTGCGCTTTGGCACTCAG
ATCGGCAATTACTCATGTGCTGCCCAGGGCACCCAAACCG
GCCAGAAGAAGTCTTTGGATCTCACTGGACCACTTTTACT
TGGCGGTGTTCCAAATCTTCCGGAGGATTTCCCCATACGG
AACCGGGACTTCGTGGGTTGCATGAGGAACCTGACAATTG
ACAGCTGTCCTGCAAAAAAGAACTTCTGCTACGAGGGTTT
GTGTCAGCACGGAGCTCAGTGTGAGAATAAGTGGAACACG
CACTTCTGCGAGTGTCCCGAAGGTCGAGGTGGCAAGAACT
GTGATCAGGACATGCCTTCACGGCAGCATTTTGACGGTCA
CGCCATGATGTTATGGAATGATCCTGACATGACCATTGCT
GTGCCCTGGTACATTGCCCTGATGTTTCGCACCAGACAAA
CAAGCCAAACAGCAACCCTGATGCAGGTCAATGCCGGTGA
CACGTCCCAAATCAACCTTCTGAAGGTGGCCGTGCTGGAT
TTCACAGATGTCCGAGTGAATGACGGGGAATGGCATCACC
TGCTCGTGGAGCTGAGGAGCAGCAAAGATGGGAAGGACAC
AAAGTACATGGCACAGGTGCTTCTGGACTACGACATGTTC
AAGAAGTCAGTAGAGATAGGAAATGAGCTTCCTGGACTCA
AACTGAAGAGTTTTTTCATTGGTGGACTTCAGGGCCAGCG
TGACATTGTCCAGCAGGGGTTTAAGGGATGCATGCAGGGT
CTCAGGATGGGGGAAACGGCCACCAGTACAGCTAACATCA
ACATGCACCATGCACAAAAGATCCGCGTGGAGGATGGCTG
TGACATGAGCGAAAACTGCGATGCCATCAACTGTCCTGAG
AACAGCCAATGCACAGACGAACACACCTGCACCTGTGATC
CCGGTTTCTTCGGCAGAGACTGTGTTGATGCCTGTCATCT
GAACCCGTGCGAGCATTTGTCCACATGTGTTCGTAAACCG
AGCTCTTCTCACGGATACACATGCGAGTGCAGTCAGGACT
ACTATGGACAGTACTGTGAGAACAAAGTTGAAAAACCTTG
TCCTCGGGGTTGGTGGGGAAACCCCATGTGTGGTCCTTGC
AACTGTGATGTCAGCAAAGGCTTCAATCCTGACTGCAATA
AGACTACTGGAGAATGTCGCTGCAAGGACAACTACTATCA
GCCAAAAGACAGTGACACCTGTTTCCCCTGTGACTGCTTT
CATTTGGGCGCCAACTCGCGAACATGTGACCCAGAGACGG
GACAGTGCCCTTGCAAGGCGGGTGTGATTGGGCGACAGTG
CAACCGCTGTGACAACCCTTTCTCTGAAGTGACTAGCACC
GGCTGTGAGGTTGGATATGAGGGCTGTCCAAAAGCCTTTG
ATTCTGGAATCTGGTGGCCCAGGACTAATTTTGGTTTCCC
TGTGGCAATGAATTGCCCCAAGGGATCTATTGGCACAGCG
GTCAGGCACTGCAATGATGAGAAAGGATGGTTGCCCCCTG
AACTCTTCAACTGTACCACCATCACATTCTCGCACCTCAA
GAAAATGAATGACGATTTGCATCGCAACGAATCCTCAATG
GATGGCCAGAAATCAAGAGACATCGCTCGCATGTTGCACA
ACGCAACCGACCAGACCTCTTCTTTCTATGGCAATGATAT
CAAGACAACCTACCACCTCCTTTCTTCAATCCTGCGCTAT
GAGAGCCAGCAGCAGGGCTTTAACCTAGCTGCCATGCGAG
ACGCCAAATTCAATGAGAACCTAGTGAAGGCTGGCAGCGC
AATCCTGGATGCCAGTAATAAAGAGCACTGGGATCAGATA
CAGAGAACAGAAGGGGGCACGGCAAATCTGCTCAAACACT
TTGAGGAATATGCCAACACTCTGGCTCAGAACATGAGGAA
GACTTACCTGAAACCCTTCATCATCGTAACAGAGAATATG
GTTTTTGCAGTGGATTACTTGGTCACTTATCCAGATGCAA
CAAAAGTACCCAATTTCCAAACTACTGACCAGGAGTGTCC
CAAAGACCTCAAGTCTTCTGTACTTTTCCCAGAATTCAGC
TTCAAATCATCAGAGCATAAAGATGATCCAGAATTTCAGA
TCAACTCTGATGAAGAGGAGAAGCAGGCTACAAACAAGAG
AAAAAGGCATGTTGAGACCATTCCTCCATTTCCTGTGGCT
TCAGTCATCATCTATAAAACTCTAGGCCAGTTTCTACCAG
AGCACTACGACCCTGACCGCCGCAGCCTCCGGGTGCCCAA
TCGCCCAGTCATTAACACTCCCATCGTGAGCGCAACTGTG
TACAGTGAAGGTCAGCCATTGCACATTCCTCTGGAGCGAC
CAATCACACTGGACTATAACCTTCTGGAGACCGAGGAGAG
AACCAAACCTGTGTGCGTCTTCTGGAACCACTCCATCACT
GTTGGTGGAGCAGGCGCTTGGTCATCCAAAGGATGTGACA
TCATCTCCAGAAACCACACTCACATTAGCTGCCAGTGCAA
TCACATGACCAGCTTTGCCGTCCTTATGGACATCTCCAAA
AGAGAGCATGGTGATGTTCTTCCTCTGAAGATTGTCACCT
ACACCACGGTCTCTGCCTCTCTGCTGGCCCTCTTTATCAC
CTTCATTCTACTGGCTATATTACACAAACTGCGCTCCAAC
CTCCACAGCATCCACAAGAACCTGGTGGCTGCCTTGTTCT
TCTCCGAGCTGGTCTTCCTTATCGGTATCAACCAAACCGA
CAACCCGTTTGTGTGTACAGTAATAGCCATCCTCCTGCAC
TACTTCTACATGTGCACATTTGCCTGGACGTTTGTGGAGG
GTTTGCACATTTACCGCATGCTCACCGAAGTCCGAAACAT
CAACCACGGACACATGCGCTTCTACTACGCCATCGGCTGG
GGGATACCTGCTATTATTACAGGTCTGGCTGTGGGTTTGG
ATCCGCAAGGATATGGCAACCCTGACTTCTGCTGGCTGTC
CGTCCACGACACCCTCATCTGGAGTTTTGCTGGACCCATC
GCTGTGGTGGTACTGGTCAACATTGTTATCTTTGTGATGG
CAGCAAAGGCATCATGTGGCCGTAGACAACGCTCCTATGA
GAAGTCAGGAGTCACTCCAGCTCTGCGGATGGCCTTCCTG
CTCCTCTTGCTTATCAGCGCCACCTGGCTGTTGGGTTTAA
TGGCTGTTAACAGTGACGTCATGACTTTCCACTACCTGTT
TGCCATCTTCAGCTGTCTGCAGGGCGTATTCATTTTCTTC
TTCCATATTGTGTTCAATAAAGAGGTGAGGAAAAATCTAA
AGAACGTTTTCACTGGAAAGAAACAATTACCGGATGAATC
CAGCACCACACGCACAACCCTACTGACGCGAACGCTGAAC
TGTAATAACACATATATGGAGGATGGAGCGCTGTTCCGCT
CGGCCATTGGAGAGTCTACGGTGTCTTTAGAGAGCACAGT
CAGGTCAGCCAAGAGTCACAGCAGCTACTTTACTTACACT
CACAGGGATGAATTGGGTCAGAAACCCAGTGTTTCTGGAA
ACGCTAAAGCCGGACTCACAGACATAGATGGCTCACTCTT
CCGTAATGGCACTAAAGCAGACGACTCAGATTCAGACAGC
GAGCTCTCAGTGGATGAACACAGCAGCTCATACGCTTCCT
CACACTCATCTGACAGCGAGGATGAAGACATCGACATGCA
GCCAAAGTGGAATAATGAGAGACAACCGCTACACAGCACT
CCAAAGGGCACAAAAGAAGTGGACACGGTGTCCAATCACG
TGAAGCCGTACTGGCCGACTGAAGCCATGACAGCCAGTGA
TAGTGAAGATCCTGGAGGAGCAGAGAGGCTGAGAGTGGAG
ACCAAAGTGAACGTGGAGCTCCATCAAGAAAATAAACTCA
ATCACATAGGAGAGAGCACTCAGGACAAAGAACAGCCAAC
ACCATCCATACAAGCCAACAGCAACCACCAGCCTGAACAG
AGGAAGGGTATTCTGAAGAATAAGATCACATATCCTCCTC
CATTGACAGACAAAAATATGAAAAACAAACTTCGGGAAAA
ATTATCAGACTACAATCCCCCAACCATTTCTTCCAGAGCA
CCCTCTATAACCTCTAATGATGGGGGCAATGGACACAATG
TCCTGATCAAGCCCCCTCGGCCACCGGTTCCTCCACGAGA
ACATCTGAACGGCATGGCCATGAATCTGAAATCAGCCACT
GTTAATGGAGGAAACCAGTCAGACTCTGACAGGAAACCCA
AGGAACCTCTGCCCTCGTGAAGGAGGAATACCAGTCTGAA
CTGCGGGAGGAATGTGGGAAGCCAAGTCGAATTACCCAAA
GAGCCCTCCGTAGGTGCACCTTGCTCTCCAGCATGTCCCT
GGGGTCCAGGCTCCATTGGAGAACAGTATTACTGCAGACG
TCTGGCTGTTTAACGAACTGATAATAGAAAATAAAGGGAA
TGTATTGAAATACGCAAGACTTTATGGAAGCTGTGCCAAA
ATGATAAACGTAGGACTACAACCACTCCCAGAATGCCGAG
CGACACACTCTAACTGAGTGCCTTTAAAGTGGATTTCGAG
AGACGCGTAATAAGACTACTTACTTACGTAATAAGAACTT
CACCACTAGTGCTTCTTAAAGAAAATGTGCACACAATTCA
CACAAGGCTGGAACTGTGTAGAGACTTTTTTTACGATTAT
GAAACGTAAATCACAGAATGCTGAAATTTTCACCAAGTGC
CCTGCTCGGCCCGTCCTCATAGAGGAGATCTGTCTCTTAA
CTAATATCTTCCTCTTGTAATTAATTGTATATAACTTGTT
GTTGTGAATTTGTAATATTATGTGGCATATTTGTATATTG
AAAAACATTTTTAATAACATTTAATGCAGGATTTTTATGT
GGTTAGATCACAGATGTTTTGTACTTGATTTGCGGATTAA
TTTGTATTTTTTCTGGTGCTGTTTGTCCCAAAACACTAGA
CTTAAAAGTGCATTAAAAACACAGTTAGATTGTTTGTTCA
ACACTGAAATTAATACAGTAAAGACATGGCTCTTAGACTC
AAGGAAATTGCAATGAATGTTCTGTTTTGCAATCAGATGT
CGGTTCATAATTCATATTCCAAAGAAGCCGCGGTGAAAGA
GAATTTGCAGGTGTTTTTAAATCAATTCTCATATCAAAAA
GACACTGGATTTTTGTTAGCTGTATTTATTTTGTGTTGAG
ACACTGGACGGAAATTGAAGCTGTAAAAATAAATGCTCTC
TCAATTTGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations