Transcript

st6galnac5b-201

ID
ZDB-TSCRIPT-090929-2627
Name
st6galnac5b-201
Previous Names
  • st6galnac5-001
  • st6galnac5b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000013729 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000013729|OTTDARG00000011769|ZDB-GENE-040912-25 st6galnac5b|OTTDARP00000011735 st6galnac5-001 LG_ BX005450.9 Danio rerio protein_coding KNOWN, 1923 bp
AGTTCGGTGTGAAGATGACAGAGCGAGCAGAAGAAGAGCT
GATGGAGGAAATACACTGTGCGTTTATAAAGCTGCTGTCT
GTGAGGCTGAACAATTTGACTGCACGAAAAGACCCGAAAT
AAAACACTTCACAATATGAAGACGCGAACGCGTCATGGGA
TCATACTGATTGGTGTTGTGACTGTGCTTACAAGCTTATT
GTTTGTCTACAACAGCACTTCTGCAGACACACCAGGGGAT
CAGCTGCATTCAGATGGACATCAGATAGATGCTGCAAGCC
GACAGACATTCAGCTTAGAAGGTTACATCAGCATCATTGA
TCATAAGCCTCTCAAGACGCACTGCAGAAGTTGTGCCTTG
GTGACGAGCTCTGGTCACATGACAGGAAGTGGTCGAGGTG
CAGAGATCGACGAAACAGAGTGTGTCATTCGTATGAATGA
TGCCCCAACAAGAAGATACCAGAAGGATGTGGGCCAGCAT
ACAAATCTCCGTGTGATTGCTCATTCCAGCATGCAGCGTG
TGCTGCGAAACCGCTACGAGCTCCTCAACTCCAGCCAGGA
CACTTTCTTTATCTTCTGGGGGCCTGGAAACTACATGCGG
AGAGACGGTAAAGGCCTTGTCTACAACAACCTGCGTCTGA
TGAAACAGTTGATGCCCAAACTTCAGGTGTACATCATCTC
ACGGCCGAAGATGCTGCAGTTTGATGAACTCTTCAAGAAG
GAGACTGGAAAGGATAGAAAAAGGTCCAATTCATGGCTCA
GCACGGGCTGGTTCACCATGGCAATCGCTATAGAGATGTG
TGACAGAATCAACGTCTATGGCATGGTTCCTCCAGAGTTC
TGCAAGTCTCCCCACACCAAGCCTTCAGTGCCATACCACT
ACTACGAGCCTTCGGGCACGGATGAATGCACCATGTATGT
CACCCATGAGCAGGGCCGGCACGGCAGCCATCATCGCTTC
ATCACTGAGAAACGTGTCTTTGCCAAATGGGCACGCATGT
TCAACATACACTTCTATCAGCCTGACTGGGGACCACCCCC
TGTCATAAACAACAACAACAACACAAACTCATGAGGTTCA
AACTTTGGGGATGTTTTCATTTGAACATTTTAAATCAAAC
ACAATGTGAATGAATGTTTATGATGATGTACTTTCTAGCG
ATTTGACACTGTAAAAAAAACATCTTTATACTTTCTGAAT
ATATAAATATTTCACAAATAAGTTAAACATGTCAAGAACA
TAGTATTCCTGATATATATTAGTGATTTAATTTTCACAGT
GTACCCGGTGATCCACATTCGCTCAGAAAACTGGGTTACT
GTATAATTATATCACATCTCTGTTTCCAGCAATTACTACT
TGGGTATCTAGGCCATATTGTTCTCCATGTGTAGTTTCAA
TTATACATACAGCCTCAATAATCTTTGCAGCTTGATGAGT
GTCAAGCACATGTTGCACATTTCTTCTCTTAATGGCGTCT
AAAGAGGAGCATTTGCAAACTGCGCATTTTGCAAAGGACA
CTTTTATCAGAAGGCTCATTAACTTTGTCTGATTCAGTTT
TTGCACATGTCAAAAGATGTTTATCTTCTAAATTAAGCTG
TACATAGAGCTTTATGCTAATATTGTCATGCTGTTAGCAG
CTCTGATCTTTCCTCAAAATCAGTTAGATACTTAGACAAA
CAGTCTCAATACGCGGTTTATTTGCTTATATTGTTTTATG
ACATCTCATTTTGTTTTATATTGATTTGTGCTAAGTTTTG
ATGCACTGACATAATGTTAGACATTGTTTAGTGTTCATTA
GATGGTTTCGGTGAAGAATTCATCAGCAGGTTTTATTTTA
TTTATTTATTTAAATTTTAAACAGTAACATGTGAATTTGC
AAGCCTTTTGAACTATTAAATTAAATAACAATTCATAAAA
AAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations