ZFIN ID: ZDB-TSCRIPT-090929-2621
Transcript Name: pgm5-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000013718 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000013718|OTTDARG00000011758|ZDB-GENE-060503-838 pgm5|OTTDARP00000011724 DKEY-91M11.4-001 LG_ AL845168.5 Danio rerio protein_coding NOVEL, 1704 bp
ATGGAGACAAACCCTATACCCATTTTGACCATCCAAACTA
CACCCTTCGATGACCAGAGACCAGGTACAAACGGGCTGCG
AAAGAAGACTGCAGTGTTCGAGAGCAATAACAACTATCTT
CAAAACTACATCCAGAGTGTGCTGTCCTCCATCGACCTGA
GGGACCGACAGGGATGCACTATGGTGGTGGGCAGCGATGG
AAGATACTTTAGCCGGGCAGCGACCGAAGTCATCGTTCAG
ATGGCAGCTGCCAACGGGATAGGACGTCTGGTGATTGGAC
ACAACGGGATCCTGTCCACCCCAGCAGTGTCCTGCATCAT
CAGGAAGATTAAAGCTATTGGTGGTATCATCCTCACTGCA
AGCCACAGTCCGGGAGGACCAGGAGGAGATTTTGGGATCA
AATTTAATGTCGCGAATGGAGGACCATCTCCAGACACAGT
GATAGAGAGAATCCACCAGGTGAGCCGCACTTTAGAGGAA
TATGCTATTTGTCCTGACCTGCACATCGACCTTTCCCGAC
TCGGCCGTCAGGACTTTGATTTAGAGAACAAGTTTAAACC
CTTCAGAGTTGAGATTGTGGATTCAGTGGAGATCTATTTC
AACCTGCTGAGGGGCATTTTTGACTTCAGTGGCATCAAGA
GCTTGCTGACAGGCCCAAACCAGCTGAAGATTCGAATAGA
TGCCATGAATGGAGTAATGGGACCATATGTCAGAAGAATC
CTATGTGATGAGCTCGGAGCTCCAGCTAACTCTGCAGTGA
ACTGTGTCCCTCTGGAGGACTTTGGAGGCCAACACCCAAA
CCCAAACCCTGCTTTCGCTGGACCTCTGGTGGACTCCATG
AAGGGCGGAGAGTTCGGCTTTGGAGCTGCTTTTGATGCAG
ATGGGGATCGTTACATGATCATGGGTGAGAATGGGTTTTT
CGTGAGTCCGTCAGATTCGCTTGCAGTGATGGCTGCAAAT
CTCTCCTGCATCCCTTACTTCAGTCAAAGAGGAATCCGAG
GTTTTGCCCGCAGTATGCCAACCAGCACAGCCATTGACAG
GGTTGCTAAGGCTATGAAAGTGGCACTTTATGAAACGCCC
ACAGGCTGGAGATTTTTTGGCAACCTGCTGGATTCGGGGA
GGTGTTCGTTCTGTGGAGAGGAGAGCTTCGGAACAGGTTC
AGACCATATTCGAGATAAAGATGGTCTGTGGTCAGTTCTG
GTTTGGTTGTCCATCATGGCAGTGCGTAAGCAGGGAGTGG
AAGAAATTGTGAGAGATCACTGGGCCAAATTGGGACGCAA
TTACTTCTGCAGGTTTGATTATGAAGGAGTGGACGGCAAG
GCAGCGTTTTACCTCATGAGAGATTTGGAGGCCGTTATCA
CTGATAAAGCTTTCACCACTCAGAAGTTTTCAGTGGGCAA
TACTGTCTACAGTGTGGAGAAGGCCGATAATTTTGAGTAC
ATAGACCCAGTGGACGGCAGTGTGTCACGGAAACAGGGCC
TAAGGATCATCTTTACCGATTCATCCCGAATCATCTTTCG
GCTCAGTGGTTCTGGGTCTGGAACAGGAGCAACCGTTCGC
ATCTATGCTGAAAGCTACGAGAGAGACCCTGAAAGACACA
ACAGAGAGACTCAGGTTGTGCTGGGTCCTCTCATCGCCAT
TGCTCTGAAAATCTCCAACATCCACGAACGAACTGGACGC
AGAGGGCCTAATATCATCACCTGA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pgm5-001 Contained in:
OTHER pgm5-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000013718 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCESNo data available
    CITATIONS (1)