Transcript

si:dkey-6n6.2-002

ID
ZDB-TSCRIPT-090929-2604
Name
si:dkey-6n6.2-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000013678 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000013678|OTTDARG00000011720|ZDB-GENE-060503-173 si:dkey-6n6.2|no_translation DKEY-6N6.2-002 LG_ BX004884.10 Danio rerio protein_coding NOVEL, 547 bp
AATAAATAATACATTTTATTTATTTAATTATCGCTTTTTT
AACTTTAAGAGCATTAAAATATTATTATTCCAAACATTTA
ACCCAAAGACCAAACGGTATTTAACCTCATCTGTAGAAAA
TGTATACGACATCAACATAACTATAAATAAATAGTGACAT
GGCAAAATGTGTGCACTTTCCTAACCTTACCCCATTTTCT
GCTGTGATGTTTTCTCAGGTTAAAGATCTTCTGGTCAGTG
AGGAGTTTAAGCCAAACTGTGCCATGGTGGTTCTGGATTT
CCTCATCAGACACGCCATTATCGAGCCAGACTCAGAGCCA
TATTATCACGAATTTGTGGCTGGTTTGCACAGATCACTGT
GAAGACTGACTGGTGGTGCTAAGACCTGTGTGAACCTTCT
ACCGTGTGGAATTTCTATCTTTTACCTCGACTTTAAAAAA
ATGTAAGCATGTGAAGCTGAAGACCGTGTCGAGCTGGTGA
AGAAATGAGGTAATTTATGCAAACGTCATCCGAAGAAGAA
ACACAAAATAAAGACCCATGCAAAGTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations