Transcript

dock11-202

ID
ZDB-TSCRIPT-090929-2557
Name
dock11-202
Previous Names
  • dock11-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000013541 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000013541|OTTDARG00000011613|ZDB-GENE-060503-196 dock11|OTTDARP00000011559 CH211-150G2.3-001 LG_ AL772340.19 Danio rerio protein_coding NOVEL, 6653 bp
TTTTAGGTGCTTACGGAGATGAAGTTCGACTTCCTCATGA
CGGTCTGCAACCATGAGCACTACATTCCTCTGAATCTGCC
CATGGCGTTCGGCCGGACCAAACTGCAGCGGGTCCAGGAT
TTTATTTCGTATGCGGCGGAGTGTTTCGGTGTCGTAGATC
AGAGTCTGGAGTACAGCTTGACTGAAGATTACTGCAAGAA
TCATTTTCTGGTGGGTTTGCTTCTGCGCGAGGTGGCTGAT
GGACTTCAGGCCTGCCCAGAGATTAGACAGCTGGCTGTGG
CTGTGCTTAAAAATCTCATGATCAAACACGCCATGGATGA
CCGGTACAATGCCTTTAAGAACCAACAGGCCCGCATCTGC
CTGCTGTACCTGCCTCTGTTTGAGCTGCTCTACCAGAACC
TGAGTCAGATGAACAGCCCCAGACAGATGTGCAGGAATGG
CCTCGGCCTGATGTACCGTGATGATTTGTCAGTGGACAGT
CGGAGAAGCAGCACCATTGTTGATAAGGAACCTTCCGGTT
CTGTCACCCAGAATGGACTCAGTAGGAGAGGAGAGTCCAG
AGGCTCCATGTATGGAGATCCGGGAACTCCAGACATCAAT
GAGTTGCACAGGCGTGGTTCCACTATGAGCACTGTACCTG
CTGCTGGACGTTTGGGCCAATATGAAATCAGAGGGCTGCT
GCTGTGTTACCTGCACATCGTAAGAACTTTGTCAGATGAC
ACTCTCACTGCTTATTGGTCGAAAGTCAATCCACAGGACA
TCATGAACTTCCTCAGTCTTCTCGAGATCTGCATAATCCA
GTTCCGCTATGTGGGCAGGCGAAACATCAGCCGAAGCCAG
GAGCCGTGGGTGTCAAAACTCTTCTCCCCTGAGAGAAAAT
CTCAGACCATGCCGGTTCTGCGAGGACGAGCCAGCTTAAT
GCAGGCCAAGCTGCAGCAGTTCAGCACTATGGACACCTCA
TTGACTCTGAACATGGCTGGAGGTCCCACAGAAGCAGAGA
TCAATCATCAGTCTTTGCTGGAGGGCAATACGTCGACGGA
GGTCTGTCTGACAGTGCTGGACGTCCTCTCTCTTTTCACT
CAGAGCTTCAAGAATCAGCTGCTGGACAGTGATGGTCACA
ACGCTCTGATGACGAAGATCTTTGACACATACCTCACTTT
ACTGAAAGTCGGACAATCAGAAACCGCAATCAAACACATC
TTTGCCTCTCTGCGAGCTTTTATCGTCAAGTTCCAGGTTC
CCCTTTTTAAAGGCCGTGTAGTGCTATGCGGCTCGCTGTG
TTATGAGGTCTTGAAGTGCTGTATGTCAAAACTAAGTGTC
CTGCGAGGGGAGGCGTCTGCCCTTCTTTACCTGCTCATGA
GACACAATTTTGACTACACAAAGAGGAAGAGCTTTCTGCG
TGTGCATTTACAGATTATCATCGCAGTGAGTCAGCTTATC
GCTGATGTGGCGCTAACCGGCAGCTCGCGTTTCCAGGAGT
CACTCTCCATCATCAACAACTTCGCCAACAGTGATAAAAT
TATGAAGACCACAACATTTCCATCAGAAGTGAAGGGCCTG
ACCATGCGGATACGTACAGTGCTGATGGCCACAGCTCAGA
TGCGCGAGCATGAAAAAGACCCAGAAATGCTGCTCGACCT
GCAGTACAGTCTCGCCCGATCCTATGCCAGCACTCCAGAG
CTCAGACGGACCTGGCTTGACAGCATGGCACGAGCGCACA
GCAAGAACGGGGACTTTTCTGAGGCTGCCATGTGTAATGT
TCATGTTGCCGCTTTAATGGCAGAGTATTTGCACAGGAAA
AAGCTATTCCCCAGTGGACTGGCAGCTTTTAAGAGAACCA
CTCAGAACATTGATGAGGAAGGAGCCATGAAAGAAGACAT
CGGCATGCAAGATGTGTACTACACTGAGGACGTCCTGGTG
GAGCAATTGGAGGTGTGTGTGGAGAGTCTGTGGAAAGCTG
AGAGGTTTGAGCTCATAACACACATCGCCAGACTCATCAT
TCCGGTTTATGAAAAGCGACACGAGTTTGAGAAACTGAGG
CGATTGTACGACACACTGCAGCGAGCTTATGCAAAGATAT
TGGAGGTGATGCAGTCGGGTCGACGGCTGCTCGGAACGTA
TTTTAGAGTCGCCTTTTTCGGACAGGGCTTTTTTGAAGAA
GAGGATGGAAAGGAGTACATCTACAAAGAGCCAAAACTCA
CAACTCTGCCTGAAATTTCCCATCGTCTCTTAAAGCTCTA
TGGAGAAAAGTTTGGCTCAGAGAACGTCAAAATCATCCAA
GACTCCAACAAAGTTAACCAGAAAGATCTGGACTCGAAGT
TTGCGTATATTCAGGTCACGTATGTCAAGCCGTTCTTCGA
TGAGAAGGAAATGGCTGAGAGGAAGACGGACTTCGAGAAG
TGCCACAACATTCAGCGTTTCGTCTTCGAGACTCCATTTA
CGCTCACAGGGAAGAAACAAGGAGGAGTTGAAGAACAGTG
CAAGCGGAGGACTGTACTTACCACCGCCAACACATTTCCC
TATGTAAAGAAGCGCATCGAGGTGGTGGGAGAGAAGCACA
CAGAGCTGAAACCCATCGATGTGGCCATAGACGAGATGAA
GGAGAAAAGTTCTGAACTCGCTAAACTCTGCTCTAATCAG
GAGGTCAACATGATCACACTTCAGCTCAAACTGCAGGGCT
GTGTTAGTGTTCAGGTGAACGCAGGACCGATGGCCTATGC
TCGAGCTTTCCTAGATGAGTCCAAATCAGGTCAATCCAAC
AAGAAAGTCAAGGATCTCAAGGAAATATTCAGGCAGTTTG
TCAATGCTTGCAGTATGGCTCTGGACATCAATGAGAGGCT
CATTAAAGAGGATCAGTATGAATACCATGAAGGACTGAAG
GCGAACTTTAAAAGCATGGTGAAAGAGCTTTCTGAGATCA
TCCACGAGCAGATCTTCCAAGAGGATATGATGCGTTCTCT
GCTCCAGAACTCTCTCCATGTGTTCAGAGCCATCAGTGGA
ACCTCCACCGACCTCAGCTAAATCCTGATGCTGCTTCCAG
ATCCTCCAGTTCTGCTCTCGACTGAATGTACAAATCCAGA
TGCTAGGCCTTCAGCTCGTGAATGATTGTCAGCGTTCTCC
ACCGTGCCATGTCGTGTACTGCTAGTTTGTGTATATACTG
CTTTTATCATTTGTTTTAATGTCAAAATGGACTATTTTAA
TGCACATTCCAGGTCTTATTGTGTTTGTTTGTAGCAACCT
TCCTTTTAGACTCATGTCACCAAGTCGCCTTATTTTCCAG
CACTTGCCCTCGGTCCATTATGGAAGCCCATTTATCACAC
AAAATCATGCATTGGAAAATTGAATTAAATATTAAAGTAA
TTAATAAAAACATAGAGTCAGCTTTAATGTATTATAAATA
TATTGCGAGTTAAAATTAAAGCTTGCCGCATTCTGAGATA
AATAATTGAACATACTGTACACTCTCAGAAATAAAGGTAC
AAGAGCTGTCACTGGGGTGGTACCTTTTCAAAAGGTACAC
ATTTGTACTTAAAGGGTCCATATTGGTACCTCAAAAGCAT
ATATTTGTACCTAAACATTTTAAAAGGAATGCTTTTGCGC
GTTTTAGTAATAATATGTATCCTTGAGGTATTAATATGGA
CCCTTTAGAAGCAAATGTGTAGTTTTTAAAAAGGGACCAC
CCCAGTGACATCTCTCATACCTTTATTTCTGAGAGTGTAT
AGTCAAAAAGGACAAAATGTTGATAATATGAGATATAATT
ATGACCAAAACAAGTTGACATGAGAAACGATGGCACAATG
CTTCAAGCTAGGAGAGAAACATCTCTGAGTTGAAGACTTT
TAAAAAGAAATATATAATGAGTTATCTCAATCTCATCTCA
TAATTATGATATAATTTTACATGTTCATGCTAGGGTTAAT
CAATTCAGACACAAAGTAAAAGAAATGTTTTATGTTAAAC
GTTAAAGGTCAGGGTTATCACAGTCATATTTGGAAAGAAA
AGTTGAAATTAGTGTAATGAGTCCTAATTATGAGATAAGA
GTCAAACTAATCAGTAACAATTATTTTGAAATTGAAACTT
TTTTGAACATACTTTACAGTCAAAAAGGTCAAAATGTTGA
TAATATGAGTCATACTTAGGACCAAAACAAGAGAGCATGA
GAAATGATGGCACACTACTTCAATCTAGGAAGGAAAAGAG
TCAGAGTTGATACTTTAAAACAAATTCTAATGAGTTATCT
CTATCTCATCTCATAATTATAACATCATTTTACGTTCATG
CTATGGTTCATCAATTAGGACACAAAAGTAGAAATTATTT
CATATATTAAACGTTTAGGGTCATAACAGTCATAACTGGA
AAAAAAAGTTGAAATTAGCTTTCCAAGTCCTAATTATGAG
ATAAGAGTCAATAATTAATAACAATTATTTTGAAATTGAA
ACTTGGTGCATTCTGAGATCAATTGCTGAACATACTGTAT
AGACAAAATGTTGATAATATGAGTAATAATTATGACCTAA
ACATGAGAAGTGACTCACTACTTCAAGCTAGGAAGGAAAC
ATCTCAGAGTTGAGACTTTTAAGAAGAAATATGAGTTATC
TCAATCTCATCTCATAATTATGACATAATTTTGCATGTTT
ATGCTACGGTTCATCAATTAGGACACAGCGTAGAACATAT
TGTATATATTAAATATTAATGATCAGAGTTATAACTGTCG
TAACTAAAAGAAAGTCATGTATCGAGTCCTAATTATGAGA
TAAGAGTCAAACAAATCAGTAATAATTATTTTAAAAGTTC
AATTTGTCCCTTTTTGTCAATTAAGATTTTAATATTTTTA
AGTTTTCTGACAATTATGGCCTTCTAAAACCTAATTATGA
GATGAAAGTTGTCCATTCATAGTTTTCATAGTTTCCAATC
ATAACTATGACTTGAAGTTTCAATATTTAAACTTTTTACC
ATAATTAAGACTCGAGTAATAAAATCATAAGCAATGATTT
TCTCATACAGTGAAAATGGGCTTCCTTGGATCAGTTATCC
AGCTATTGACCGCTATATGACCGCTTTATATGATTTAATA
ATTTATCAGTGGATAAAATCAAGTCCAATGTAATTTTTTA
CATATTCTTGAAAGTCTGTCACATTTACAGTAAGAAAAAT
GGGTCAATAATGCCATCATAACTTGACTGTAAATGATACG
TTGTATTTTTTTTTTTTCAATCCCAGCCAAACAAGCCATT
TAAATAACACCACTGGGAAAAACACCTACTGGTGCAGTGA
TGATCAACCAAAGATCAGGTGCACAGTTTATGCTGCATGC
TTGCGTTTCCATATTATATCACTTCTTCTGAAAATTCCAG
GTGATCTTGAATCCTCAATCCGTGACATTGTATTGAATGA
TGATATTCAGGATTGTAAAAACGCCTGCATTTTAGCAAAA
TATGTCTTCCGAAAATCTTCAGTCTTAACACACAAACCAA
CTTCAAAATTAATCACATCGCAAACTTTCATGACATGTTT
GGAAGGTAAATATTTTTTTTTGTATTGATTTTTATAGTAA
TTTAATAAATTTTTATGTATTCAAATCAAGCAAATGAAGG
TGCAATTAAAATTTGAGTTTTTTATTAATTATTTTTGACT
TTTTTACTGATCAAAATGATTACATTAGTGTCCTTGTTTA
CATCACCTTTCATTTAAAAAATATATTTTGTTGCTTGTTG
AAACTACTTATTTAAAATGAGCTGAAACAACACAATTCTT
GAGATTTTGATGGGCCAACTAACTTTTTTTTTAAAGTTCA
ACCCACTTAAATTTGTAAAACTAATAAGTTAACCTAATTC
CTTTATGTTGTCCCAACACAAATCGGTTGTGTGGAACCAG
CAGTGTTTATTTATATATGTTTCCTGGTGCAAACTGCATA
ATAGTCTGATAGATGCATCTTTTTTTAAGAAGGTCAGTGC
TACTGCCATCGAAACTAACTGTAAAACTAGCTGCTACTGT
ATGTGGTCAATCTGTCCCTCTTCCCTATTTTCAGTACTAC
ACAGTGGTTACCAGATCATTTCTCTCATTAAATTCAACTG
AAACCATCTGGAGTTATTATATGCAAAGCTTTTTCATTTG
AATGCAGTAGGCTGTAATCACGGATGTTAAAGAATGTCTG
ATTTCATTGGCGGAAATGCAGAATGTACAGTAGCAGCAGA
TAGATTTTTGTGATTCCCTTTGTTTTATTGGCTGGTCGTC
TGGTTTTCCAGGACATCCAGGGTTAATTTATTGACGAATG
CTGTTAATGCTTATCTGCTGCACTGAATATGCAAATTACA
AACAGAGGATGTGTAGATTTATATAGGAAAGCTGTCCGTT
TGTTGTAAATGTACATTATGTAAGTATGAGCGCATGGAAA
TGTATACAGTATTGAAAGAACAGTATTTGCGAGCACTCGT
ATTGCTCAGATGTCTGGATTTATTAGTCTAGAAGCCATCT
GATAAACAACGGACGGTTAATTTGCTAGAAAGCGGATGGT
TTGAGACCATTTCCCAATATTAGTTTCAACATTTCCTTCA
TGTTTTGTCAGCATATATTGTGCGATTGTTGATTCTTTCT
TTTTTTCTCTCGGTCTCATCTGTAGTTCATAAGATAAAGG
GTGTATTTCTAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations