ZFIN ID: ZDB-TSCRIPT-090929-2545
Transcript Name: p4hb-201
Previous Name: p4hb-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000013518 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000013518|OTTDARG00000011594|ZDB-GENE-080610-1 p4hb|OTTDARP00000011542 p4hb-001 LG_ BX005286.6 Danio rerio protein_coding KNOWN, 2852 bp
CTGTTTCCTGCTTACATTGCCACGTTATTAGTGGCAGACC
CAAAATACAAGGGACTACAAAGCTGTTAAAGGTGGAAGAA
AATCTGACGCGTTTAATAGTTAACCTTCTTTCCTTCACGG
ACATCTTAATTTTTGGTACGCTTTGGGTAAATCTGACATG
TTGAAATTTTTGATTGTGTGCGCACTGGCCGCTATGAGCG
CGGCTGAAATTGCCGAGGAAGAAGACGTACTCGTATTAAA
GAAAAGTAACTTCGAGGAGGCACTGAAAGCTCACCCAAAT
GTCCTTGTTGAGTTTTATGCACCATGGTGCGGACACTGCA
AGGCCTTGGCCCCTGAATATTCCAAAGCAGCTGGAATGCT
AAAAGCTGAAGGCTCAGATATCAGACTAGCTAAGGTAGAT
GCTACAGAAGAATCAGAACTTGCTCAGGAGTTTGGTGTTC
GTGGGTATCCCACCATCAAGTTCTTCAAGGGAGGAGAGAA
AGGGAACCCTAAGGAGTATTCTGCTGGTCGACAGGCTGAG
GACATCGTCAGCTGGCTGAAAAAACGAACTGGACCCGCAG
CCACTACTTTAAATGATGTCATGCAAGCAGAGTCAATTAT
TGCTGATAACGAGGTTGCAGTAATTGGATTTTTTAAGGAT
GTTGAATCAGAAGATTCTAAGGCCTTCATTAAAACCGCAG
AGGCTGTGGATGACATCCCCTTTGGAATCACTTCTGATGA
TTCAGTCTTTGCAAAGTTTGAAGTTGCCAAGGATAGTGTT
GTGCTTTTTAAGAAGTTTGATGAGGGTCGAAATACTTTCG
ATGGAGAGGTCAGCAAAGAAAGTTTACTGAACTTCATCAA
GGCCAACCAGCTTCCCCTGGTCATCGAGTTCACAGAGCAG
ACTGCTCCCAAAATCTTTGGAGGTGACATCAAGTCCCATA
TCCTAATGTTTGTGCCTAAAGCAGCCAAAGACTTCCAGGA
TAAGATGGACCAATTTAAGAAGGCAGCAGAGGGTTTTAAA
GGCAAAATTCTCTTCATCTTCATTGACAGTGATGTGGATG
ATAATCAGAGAATTTTAGAGTTCTTTGGCCTTAAGAAGGA
AGAATGCCCGGTCATCCGCCTTATCACCCTTGAGGAAGAA
ATGACCAAATACAAACCAGAATCTTCTGAAATAACAGCAG
AGAACATAATCAGCTTCTGCACATCCTTCGTAGAAGGGAC
ATTAAAGCCTCATCTGATGAGTCAGGACATTCCTGAAGAC
TGGGATAAAAATCCTGTCAAGGTCTTGGTGGGAAAAAACT
TTGAAGAGGTTGCCTTCAATCCTGCTAATAATGTCTTTGT
AGAGTTTTATGCCCCATGGTGTGGTCATTGTAAGCAATTA
GCCCCTATCTGGGATCAGTTGGGTGAGAAATTTAAAGACA
ATGCAAACATTGTTGTGGCCAAGATGGATTCCACAGCTAA
CGAAATTGAAGCTGTCAAAGTGCATAGCTTCCCCACACTC
AAATTCTTCCCTGCTGGTGATGAACGTAAGGTAATTGACT
ACAATGGTGAGAGAACACTAGATGGTTTCACAAAATTTTT
GGAGAGTGGAGGAAAAGAAGGTGGGGCACCAGTTGGAGAT
GAAGAGGATGAGGAAGCAGATGATTTGGATCTTGATGATG
CAGAGGAAGATGATTCAGATGTGGAAGAGGGACATGATGA
GTTGTAAGGACCAGGGGTAAAAGATGAGAAAACCCCTTGA
CCACCACATCTTTCAACCTGCCTGCCTGTGAACACTGATG
CTTTTCCTTACTAATCCTACAGCCAACATGCATTACAGGG
TCTCATGTCAGCCAGTACATTGCCACCCTAGTCAAGTCCA
GAAGTACCTCTCTGCCCGCAACAACTTTGTTTTATTTTAC
AGTTTCATTTGGCATTAAGTCTATTTTATTTTTTTGTATT
GGTAATGTTTTACTGCCTTTTTTTTTTATACTGGCCTGAT
GGTTCAGTTAAGTTTGCCATTTTAATTCTGGTAATACTCT
CTCTGGGAATTCAGTTATTTTCTTAATTTTATATGAATGT
TGAAGGTTTCAGGGCAGATGGGCTTTCTATTGATTGTCAT
GGGGGGAAAAACCTATTATACTGGGCTGCTACTGTAGTGC
TAATAAAACTTAGCCAAGACCAAATTAAGGTACCTTCCCT
GTTTATAGACTTTCAGTGCATTTAAAATTATGAACACCTG
CTACTGAATTGGTTAAGACATAATGGTGAAGAATTAATTT
CTTTTTTATTTTTTAATCTAGCTTTGTAAAGGGCTTGTAA
TTTTATATTATTATTATTATTATTATTATTATTAGTTTTT
TTTTTTTTTTTTTTTTTTTTTTAACCAGGGAGATGATTTG
AGACCACCCTCTTGCACATGATTCGGTGCCATCAGAGATT
CCAGAAGAGTTACTGAAATGGTTAATCTGTCATCTTGTAA
AGACTAACTCATTTCCCATACCCTTTTTGCCTTCTGTTTC
TCTAAAGTTTCCTTTCAACTGTCGGTATCATGGCAGTTGA
TTCTGCCCTAGTGGTCGCTGTGACTGGAAGGAGAAAATGG
CATAGTAACAATCTTAATCTGTCTTTTCCCCTTATGTCAG
AGTTCAGGCTTGTGCGAGTGCATGTGTGTGTGATAGATGG
AGAGAGAGAGATTTGTTAACTCTTCTGTTATCTGTCTTTA
TTTTTCTAGGAGGGGTGAATTTCAGGGGTGATGTTTGAGA
TTACGGAAGTAGGTTTGGGAATGTAAATTGGGTGGGGTTT
GGGTTTTGAAATGAGCAAACATATTTGAGAAAGCATTCCA
TTGTGTTTAAATTGACAGTTAACTGATGGCCAAATAAATG
ACAAAACGATGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
p4hb-201 Contained in:
[BAC] DKEY-237I9 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000013518 (1),  Ensembl_Trans:ENSDART00000167937 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BI890770 (1) 728 nt
GenBank:BF158119 (1) 693 nt
GenBank:BI887648 (1) 660 nt
GenBank:BG304002 (1) 603 nt
GenBank:BQ261793 (1) 595 nt
GenBank:BM154582 (1) 576 nt
GenBank:AL911624 (1) 539 nt
GenBank:AL911625 (1) 539 nt
GenBank:BQ261744 (1) 537 nt
GenBank:AL911627 (1) 518 nt
GenBank:BM860751 (1) 370 nt
GenBank:BM154260 (1) 355 nt
GenBank:BG303075 (1) 305 nt
CITATIONS (2)