Transcript

si:dkey-237i9.1-001

ID
ZDB-TSCRIPT-090929-2544
Name
si:dkey-237i9.1-001
Previous Names
None
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000013515 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000013515|OTTDARG00000011591|ZDB-GENE-060503-441 si:dkey-237i9.1|OTTDARP00000011539 DKEY-237I9.1-001 LG_ BX005286.6 Danio rerio protein_coding NOVEL, 591 bp
CAGGAGTAGCAGTGTTTTCTCACCCGTTGTGTTATGGGAA
CAGGGTCAACAGCAGTGAGTCTGTTCCAGGTCTGATCTGG
ATTACTGGCTGGTTTGACTCAGAGACAAAACAACAGCCAT
GGAAATCCCTTTTAACGTTAGCATCTAAAAACTGAAGCGG
ACGCTTGACATTGAAAAGGGCTTTATCAATTTCTACGAAT
ACTTTGTTTTTGTAATTTATACTTCAGCACTGCCAAAGGT
TCCATCATGGTGCAAAAGTATCAGTCCCCTGTGAGGGTGT
ACAAACATCCTTTTGAACTTGTCATGGCAGCATATGAGAG
GAGATTTCCCACCTGTCATCTGATCCCCATGTTTGTGGAC
AGTGATGTGATCAGTGAAGAGAACAGTGAAGATGGTTCAT
TTAATAAGATTGAGAGGAGGTGTAAACTTGATGTGGATGC
ACCAAGACTCCTTAAACGGATTGCAGGTGTGGATTATGTC
TACTTCATTCAGAAAAACTCTCTGAATCACAGAGAAAGAA
CTCTTTGTATTGAATCGCACAATGAAACCTTCTCTAACAG
AGTTGTCATCCATGAACTTTGCTGTTACTCG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations