Transcript

slc16a10-202

ID
ZDB-TSCRIPT-090929-251
Name
slc16a10-202
Previous Names
  • slc16a10-001
  • si:ch211-241j12.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000004350 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000004350|OTTDARG00000004158|ZDB-GENE-040724-214 slc16a10|OTTDARP00000003955 slc16a10-001 LG_none CU993816.3,BX511077.4 Danio rerio protein_coding KNOWN, 1591 bp
GTTTGTGTGTGTGTGTGTGTGTCAGTGAGCAGCAGCTCGC
CACAGTGTTGGAGACCATGACGGAGCCGGAGCCCACGCTG
GAGCAGGAGCCCACGCCGGAGCCGGAGCCCACGCAGGAGC
CCACGCCGGAGCCCACGCCGGAGCCGGAGCCCACGCAGGA
GCCAGAGTCAGAGCCGGAGCTGGAGCTAAAGCAGGAGAAC
GGCTGCACTAAAGCGAGCGAGCAGAAGTCACCGGAGGAGT
TCGAGCCCCCCGAGGGCGGCTGGGGGTGGGTGGTGATGCT
GGCCTCCATGTGGTGTAACGGCTCGGTGTTCGGCATCCAG
AACGCCTTCGGCATCATGTTCGTGTACCTGCTAAATGAGT
TCGGCTCCGAGCACGACGCCGACCTGCGCTTCAAAACAGC
ATGGGTGGGCTCTCTGTCGATGGGCATGATCTTCTTCTGC
TCTCCAATCGTCAGCGTGTTCACGGATCTGCTGGGCTGTC
GGATCACGGCTGTGGGGGGAGCTGCAGTGGGCTGTGTGGG
GCTGCTGGCCAGTTCATTCGTCACGTCTCTGGGCCCGATG
TACTTCACCTACGGGATAGTGTTCGCGTGTGGCTGCAGTT
TTGCGTATCAGCCGAGTCTGGTGATCCTGGGCCACTACTT
CAAGCGCAGGCTGGGTCTGGTGAACGGCATCGTGACGGCG
GGCAGCAGCGTGTTCACCATCACGCTCCCGTACATGCTGT
CGGGCCTGCTGAAGAGCGTGGGGCTGTACCACACGCTGCG
GGTGCTGGCCATCTTCATGTTCATCCTCATGCTGGCCGGA
CTCACCTACAAACCCCTGCTGCCCAAACCCGTCAGCAGCA
GCAAACCCGGCAGCCGCTGCCCTCCGCTCAGCAGGATCTT
CAACGTCAACATCTGGAAGTCTCTGGGCTACCGCATATGG
GCCTTCGGCATCCCGGCGGCCCTCTACGGGTACTTTGTGC
CTTACGTTCATCTGATGACACATGTGGAGGAGCGCTTCGG
ACCGGAAGCTAATAAAGAAGTTCTGCTGGCCTGTATCGGC
ATCACGTCCGGCGTGGGGCGTCTGATCTTCGGCAGAGTGG
CTGACTACGTGCCTGGAGTTAATAAAGTCTTCCTGCAGGT
GTCTTCATTCATGGTGATCGGCGTGATGTCCATGATGATT
CCTCTGTGTCATGTGTTCGGCGGGCTGATCGCCGTGTGTC
TGCTCATGGGGCTGTTCGATGGCTGCTTCATCTGCATCAT
GGCCCCCATCGCCTTCGAGCTGGTGGGCTCCCAGAACGTG
TCTCAGGCCATCGGCTTCCTGCTGGGCATGATGTCCATCC
CCATGACCGTCGGCCCGCCCATCGCAGGGTTTCTGCGGGA
CCGTTTGGGCAGCTATGACGTGGCGTTTTACCTGGCCGGT
ATCCCCCCCCTCATTGGTGGAGCAGTGCTGTGTGCCATTC
CCTGGGTGGAGGCGCGCAGGAAGAGGAGAGAGGCGGCAAA
CACAGCCGAAAACACAGAGAAGATGCTGGAGAGCAGGAGC
CCCCCGCTGGAGGACACCGTCTGCAGGACTGAAGAGCCCG
AGTCCGTCATCTGAGGACAGCACACACACAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations