ZFIN ID: ZDB-TSCRIPT-090929-2490
Transcript Name: cart1-201
Previous Names: cart1-001, si:dkey-37m8.9-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000013376 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000013376|OTTDARG00000011476|ZDB-GENE-030131-8025 cart1|OTTDARP00000011422 DKEY-37M8.9-001 LG_ BX005105.6 Danio rerio protein_coding NOVEL, 472 bp
TGCTTCCTAGACACGATGGTCGGAGAGCGGATCTTTCTCC
TGACCGTCACCTGCTCTGTTTTAATGCTGCTGGTTTGCTG
TGATGAAGTTCTGCAGATCCGCTCGCCTGAGGAGGATAAG
GCTCAGGAGGAGAAAGAGCTGATTGAAGCTCTTCAAGAAG
TTCTGGAAAAGCTGAGAAATAAACAGATTCCTGCTGTGGA
GAAGAAGCTCGGCTGGGTTCCATCGTGTGATGCAGGCGAG
CAGTGTGCGGTGCGGAAAGGCTCCCGCTTCGGGAAGTTGT
GCAGTTGTCCAGGAGGAACCGCCTGCAGCTTCTCCATCCT
CAAGTGCTTGTGAGAGGGAAAAAACAGCCTCAGTCTCTCA
TAATGCTCCAGTGTGTTGTTTACCATCATCAAATCTGTAA
CATGTTTATCAGTACATACAGACGAATGTATAAATGCATT
CAAATCAAATAAATGCATGCAGTTTTGTATAT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cart1-201 Contained in:
[BAC] DKEY-37M8 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000013376 (1),  Ensembl_Trans:ENSDART00000131451 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AW280905 (1) 465 nt
CITATIONS (2)