header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-2490
Transcript Name: cart1-201
Previous Names: cart1-001, si:dkey-37m8.9-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000013376 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000013376|OTTDARG00000011476|ZDB-GENE-030131-8025 cart1|OTTDARP00000011422 DKEY-37M8.9-001 LG_ BX005105.6 Danio rerio protein_coding NOVEL, 472 bp
TGCTTCCTAGACACGATGGTCGGAGAGCGGATCTTTCTCC
TGACCGTCACCTGCTCTGTTTTAATGCTGCTGGTTTGCTG
TGATGAAGTTCTGCAGATCCGCTCGCCTGAGGAGGATAAG
GCTCAGGAGGAGAAAGAGCTGATTGAAGCTCTTCAAGAAG
TTCTGGAAAAGCTGAGAAATAAACAGATTCCTGCTGTGGA
GAAGAAGCTCGGCTGGGTTCCATCGTGTGATGCAGGCGAG
CAGTGTGCGGTGCGGAAAGGCTCCCGCTTCGGGAAGTTGT
GCAGTTGTCCAGGAGGAACCGCCTGCAGCTTCTCCATCCT
CAAGTGCTTGTGAGAGGGAAAAAACAGCCTCAGTCTCTCA
TAATGCTCCAGTGTGTTGTTTACCATCATCAAATCTGTAA
CATGTTTATCAGTACATACAGACGAATGTATAAATGCATT
CAAATCAAATAAATGCATGCAGTTTTGTATAT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cart1-201 Contained in:
OTHER cart1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000013376 (1)
  • Ensembl_Trans:ENSDART00000131451 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AW280905 (1) 465bp
    CITATIONS (2)