ZFIN ID: ZDB-TSCRIPT-090929-24
Transcript Name: slc1a4-201
Previous Name: slc1a4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000001925 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000001925|OTTDARG00000001803|ZDB-GENE-030616-566 slc1a4|OTTDARP00000001703 CH211-101N13.5-001 LG_ AL772154.4 Danio rerio protein_coding NOVEL, 1874 bp
ATGGAGGAGAAGAAGAGCGAAATCAACGGACACGCTGGGC
ACAAATGCTCGTTACCAACGGTCTCAATAAAATCAGAAAA
GAAAAGCTGTAAGGACAAATGCGCCGGTTTCTTCAAAAGA
AACCTGCTGGTGATCATGACGGTGTCCGGGGTCCTGGTGG
GCGTCGGGCTAGGGATGATGGTACGGAACATGAACCTCAC
CCGTGCGCAGATGACTTATTTCGCCTTCCCCGGAGAAATG
CTGCTGAGGATGCTCAAGATGATCATCCTCCCTCTGGTGG
TGTGCAGTTTAATTTCTGGCGCCGCGAGTCTTGACACGCG
CTCGCTGGGAAAGCTAGGAGGAATCGCCGTGTCTTACTTT
CTGGTGACCACCCTAATCGCTTCATCTATCGGGGTCGCGC
TCGCCTTCATCATCAAACCGGGAGTGGGAGCCGGAGCGCT
CAACACCAACAACTTGGGGCTGGAAGGCGTGAGCAACAAC
AAAGAGACGGCGGATTCGTTTTTAGACCTTGCGAGAAACC
TGTTTCCATCCAACCTAGTGGCTGCGGCTTTCCGCTCAGT
TCCCTTTGGAACAGACACAGATGGAATGAATATTCTGGGT
CTTGTTCTCTTCGCTATGGTTTTTGGAGTTGCTTTGAGGA
AGCTTGGGGCAGAAGGAGAGGAGCTCATTCGCTTTTTTAA
TGCCTTCAATGAAGCCACTATGGTGCTTGTGTCCTGGATC
ATGTGGTATGTGCCTTTTGGCATCATGTTCTTGGTTGGCA
GTAAGATCGTGGAGATGGAAGATGTGGTTCTGTTGGTCAC
TAGTTTGGGAAAGTACATTTTCGCCTCAATCCTGGGCCAC
ATCATCCATGGTTGTATTATCCTACCTCTTATCTACTTCG
GCTTCACTCGTACAAACCCCTACAGTTTCCTGTCTGGCCT
CATCACACCTTTTACCACTGCCTTTGCCACCTGCTCCAGC
TCAGCGACTCTGCCCACCATGATGAAGTGTGTAGAGGAGA
ACAACGGTGTCGACAAACGAATCAGTCGGTTCATTTTACC
TATCGGAGCCACTGTTAACATGGATGGAGCGGCCATTTTC
CAGTGTGTTGCTGCTGTGTTTATTGCCCAGCTCAACAATG
TTGATCTTAACGCAGGCCAGATCTTCACAATCCTGGTGAC
AGCCACCGCTTCTAGTGTGGGAGCAGCAGGTATTCCAGCC
GGAGGAATCATCACCATCGCCATCATTCTGGAAGCCATTG
GTCTGCCAACCCATGACCTGTCACTCATGTTGGCCGTAGA
CTGGATTGTAGACCGCACCACTACTGTGGTGAATGTGGAG
GGTGATGCCCTCGGTGCTGGAATCCTTCACCACATCAATG
AGCAAGAGATGAAGAAACAAAAGCATCAGCAGGAGCATCA
GGAGGAGCAGGAGCTGCTGGAGGTCAAGGTGGAGGTGGTT
GCTAACGTCAAAGCAGAAGAGGAAACCTCCCCACTCGTCA
CACACCAGAACCAAGAAGAAAACTCCTCACGCGAAACACT
CAATGACAAGGACGGTGTGGAGTCTGTGCTGTAAACTGTC
AACTGTGGTCTCTCATATCCTTCTCCTTCACTCTTTCTCT
TTTACTTTTTAAAAAAACCACTAAAGACGTGATGTCGCTG
TGAAGTTTACATCAAACATAAGGTTTACTCGAATCTGTGA
ATGGAACACTAATGGCCAGTCTGTTTTACATTTAGTTTGA
AGTATTTTACAGTTATGATAATCTTATCCAATTGTGCCAA
ATCGTTGGTTTTTGTGTTTGGGAACATCCCAGATTATATG
TAAAAGTCGAAAAGGGAATATTTCCAATTTGCAAGAAGAT
AACAATGGATAGTAATGAAAACCAGTCACCGACT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc1a4-201 Contained in:
[BAC] CH211-101N13 (1)

Genome Resources: Vega_Trans:OTTDART00000001925 (1),  Ensembl_Trans:ENSDART00000043004 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AI585183 (1) 559 bp
CITATIONS (2)