Transcript

mfsd2b-202

ID
ZDB-TSCRIPT-090929-2366
Name
mfsd2b-202
Previous Names
  • mfsd2b-001
  • si:dkeyp-115a10.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000012932 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000012932|OTTDARG00000011136|ZDB-GENE-041210-308 mfsd2b|OTTDARP00000011102 DKEYP-115A10.4-001 LG_ CR545466.9 Danio rerio protein_coding KNOWN, 2090 bp
GTGTGTGCGTGTGTGTGTGTGTGTGATGGAATGAACCCGC
AGTTCATCACCGCTGCAGCAGCTGCGCGCCTCACCGCATC
CCTCAGTATGTGAATGAACACAGCTGTAACAAGCTCTGTG
AAGCCAGAGAGTTTATCTGCCGTCTCTGTACCGGCTGCCA
TGGCCAAAGGAGAGAAAGCCCGGGTCACATCAGGGGATAA
ACTCATGATGAAGCACCCCGAACCTGCTTTCACCAAGGTT
CCGCCACAGACTCTTCTGGATCAGAAGCTCTCGGTGTGCA
GTAAATTATGTTTCGCCATTGGAGGAGCACCCAATCAGGT
CGCAGGAAGTGCAACAGCATTTTTCCTCCAGATATATCTG
CTCGACATCGCACAGATTAACCCGTTCCAGGCTTCCATGG
TTTTGTTTGTTGGCAAGGCCTGGGGTGCAGTGACCGACCC
CATTGTTGGCTTCTTCATTACTAAGAGCAAATGGACAAAG
ATCGGACGACTTATGCCATGGATGGTGGGCTGCACTCCAT
TCATGGTGGTCTCCTATTTCTACCTTTGGTTTGTCCCACC
ATTTACCAACGGGAGGTTCATGTGGTATCTGGGCTTTTAC
TGCCTCTACCAAACTCTCATCACATGTTTCCACGTGCCTT
ATTCTGCTCTGACCATGTTCTTGAGCACTGACCAGCGCGA
GCGAGACTCAGCTACAGCTTACCGTATGACAGTGGAGGTT
TTGGGAACTTTAGTGGGTGCCGCCATTCAGGGTCAGATAG
TAGCGAGCGCACACACTCTGAAGCACTGTCCACATCGCAA
CCTGACGGCTGCTCACCTGACCAACAGCAGCGGCACTGAA
ATTATCAGATCACTGGCGCTATCACAGGACTTCCTGTCAC
ATGCTAAGGAAGTGTACATGATCGCTGCTGGCGTGATCGG
TGGCCTGTTTCTGGTTTGTACGGTGGTCATGTTTTTGGGA
GTCAAAGAGAGAGATGATCCCTATGCTCCTAAAACAGACA
AGGCTATTCCTTTCCACAAGGGCTTTATTTTAGTCATGAA
ACACGGCTCCTACCTCACTCTGACTGCATCTTTCCTTTTC
ATATCTGTGGCCATCCAGCTGATTCAGAGTAACTTCGTGT
TGTTCTGCACATACGCGGTGGAGCTGAGAGATCACTTTCA
GAACATTGTTTTGACCATTTTGATGTCGGCAGCAGTGAGC
ATCCCGTTCTGGCAGTGGTTTCTTGAGAAGTTTGGGAAGA
AGACGGCAGCTTTCTGCGGCATAACATGGATTATGCCGTT
CACAGTGATGCTGGTGTTCATCCCGAATTTAATAGTGGCG
TATGTGGTGGCCGTGTCATCTGGACTCAGTGTGGCCGCTT
CTCTCCTCTTACCCTGGTCAATGTTACCCGATGTAGTCGA
TGACTTCAGACTGGCGAACCGCAACTCAAAGGGACACGAG
GCCATCTTCTACTCTCTATACGCTTTCTTCACCAAATTCG
CTGCAGGCATTTCTCTCGGAGTTTCCACACTTTGTTTACA
GTTTGCAGGTTATGACACTGGAGCGTGTCGACAGCCTCTT
CCAGTGGTTTACACACTGAAGCTGCTCATTGGCGCTGCCC
CGGTGGCCTGCATCACCACCGGCCTCATGATCCTCGTGGT
TTATCCTATAAGCGAAGATGTCCGGTTACGAAACAAAGTT
GCTCTAGAGGAACTCAGAAAGCAGAGCATCACGTGTAAAA
CTCTGCGAGCTGATCTAAGCAGCGTGTGACTTCTTCAAAC
AGCAGATCCTGATATTCCAGCCTCGCGCTGGGATGAGCTG
TTAGTGTATATTACACTGTGTGACATATATCATGTTTTAC
TGTAAACATCTCCGTTTGCTTCTGTATCCAGTCCGTTTCT
GTATTTTTACATGAACATTAATAGCCACATATTCAGTTTT
ACGCTAATTTATACACACGGATGGACTATACATACATATA
TATCATATATCAGGATTTCCTCAGGGAAAATAAACTGATA
GTATATTGCTTAAATTGTATTAGTGATTATAATTATTATC
GAATGACTCACTGAATTCATGCATTAATAAAACTTGTGCT
GGTTCACGTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations