Transcript

mir9*-002

ID
ZDB-TSCRIPT-090929-23565
Name
mir9*-002
Previous Names
None
Transcript Type
miRNA
Annotation Status
miRBASE
Associated With Genes
Strain
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Target Genes
Sequence
MIMAT0003156 (1) [ Show ] (double-click sequence to select) [Download]
>lcl|MIMAT0003156|ZDB-TSCRIPT-090929-23565 LoadedMicroRNAMature mir9*-002 miRNA 21bp
TAAAGCTAGATAACCGAAAGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations