Transcript

zfp36l1b-201

ID
ZDB-TSCRIPT-090929-235
Name
zfp36l1b-201
Previous Names
  • zfp36l1b-001
  • zfp36l1l-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000004227 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000004227|OTTDARG00000004044|ZDB-GENE-030131-2391 zfp36l1b|OTTDARP00000003838 zfp36l1b-001 LG_ BX649319.8 Danio rerio protein_coding KNOWN, 3021 bp
AGTTTTGGCAGGACAGAGGGGGCTCTCTGCGGGGCAGAAC
TATATCAAAGACCCTTCAAACACAGGAATACTCCCACCGT
GCCTTAACAAACCATATGTTTGTCAACTTTGAAGAATTTT
CAGCCAGCCCCGATTCGACAATGACTGCCGTTGTGTCCTC
TTTCTTCGACTACGAAGTGACGAATAAGAACAATAAGGTG
ATGACCTTCAACAGTCCCCTCTCCAGTCCCCATTTACAGT
CTGTCCCCTCCATGGGTGCCAATTCCTCCTTTACCCCCAC
CGGGACCCTGCTGGACAGGAAGGTGGTGGGTGCCCCTTCA
GTGGGACTCTATCAGCGCCGCCACTCTGTGTCCGTTACCA
GTTCCAAATCAACACAGAACCAATTTATAAACAATCTCAA
GATGGACAACTCGGCCTCCATAAACGGCAGCAGCAACAAC
AAGGAGAACCGCTTCCGTGACCGGTCCTTCTCCGAAAACG
GGGAACGTCTGAGGCCAAGCAGCATTACATGCATTAGTGC
CAATGGAAATGGCCAGGTCAACTCAAGCCGCTATAAGACC
GAACTCTGCAGACCCTTCGAAGAGAACGGCACCTGTAAAT
ACGGCGACAAGTGCCAGTTTGCTCATGGGATGCACGAGCT
TCGTAGTCTAAATCGCCACCCTAAGTATAAGACCGAGCTC
TGCCGCACCTTCCACAGCATTGGTTACTGCCCGTATGGGC
CACGATGCCACTTCATCCACAATGCCGAGGAGCGCCGCGG
ACCCCCTCCTCTCTCATCGTTCAATAAGATGGAGCGCCCC
CGTCTTCATCACAGCTTCAGTTTTGCCGGTTTCCCAAGCT
CAGGTGGTTCCCAGGACAGCCCAACCTCTGTCACACCTCC
GCCCCTGTTTTCCGCAGAAGACCTCAACGAGTGGTCCAGC
AACCCGTTTGCTTTCTCAAGTCAAGAGCTCGCCAATTTGT
TTGTACCCAGTTTAGGTGGTACCACCATTCCCGATCTGCC
TGGTCCTCACTCACCCACCTCCTTCTTCAGACCCATGTCC
GAGTCTCCACCAAGCCCTCCAGACTCCCTTTCCGACCAGG
AAGGCTACCAGAGCAGCTTGGGCAGCCAGAGCGGATCTGA
GTCACCACTGCTGGATGCAACGCGTCGCCTTCCCATCTTC
AGCAGACTCTCCATCTCTGACGATTAAAATCTTTCCCGAG
AGGTTTTAGGCCTGAGAGAGAAGGCATGGAGAGCTGGCGA
GAATGAGAGAGTAATTTTCCTCCTAGCAATCCCTTCCTGT
CCTTGCTTTGTTTACAGCAGAGAAGTGGACTAAAGTACAG
TGTTCTTGTAGCCACTGAGTCAAATCAGAACTTACTACCC
CCCTGTAGCATCAAACTTAAGTGTCTACCCGTGCCTCCCT
AGACGTCGTTAACATGCCTGACGTAATGCAAAAACCAGAA
CTGTTCCCTTCAAGGCCTACTGGAACATGCTAAATCCATA
CTTAGGTTGTGGTGTTCAAACTAAAGTGCGGTTTCCTGAA
TCATCCAAGGACCTTCTTGTTCAAAGAATCTACTGAATTT
TATAACATCAGACCTAAAGGTGCCACTTTTCTTGCAGGAG
ATCCTTGCTGGTAGATCATCGGGACTTAAAGTGCCTATCA
AACTAATTATTTTCCTACTTTTCCAATCAAAGTGATTATT
GTCCGGGGTAGAAAAGGTTTAAAGAAAAGAATCAAACCCA
TCTGAGAGTTGTATGAATCATTCTGAAAGTATGCCTAGTG
GTGCTAAATGTGCTGTCACCGTGGTAATTATCCCTAGAAC
ATGTGATCCCTCACTCTTAAAAAAAAAGTGTCCGCTGGTT
GTTGGATTATGTAAGAGAGAAGAGGTCCTTCCTTTAATCT
TTCTGTTGGAGTTACCACTAAAGATATGACTTCAGTGGCC
ACTAATTTTTTGGTTGAAATGTTTCAATATCATTATTTCA
ATATCGTATTTCCCCTATTATTGTTATAATAACGTTATTA
TTGCATCATTACAACTCTTGTTGGTATTTTCTGTTTGGAA
AATGAGAACTTTCGAACCGAAAGTTTTGCTTGTCAATGCT
TATTTAACTTATCAAAAATGTATTTATTGCTGATTGTAAG
CATTTTTTTATTTTGTTTGTATTTATCTGGATAATGAAAC
AATAGAATATATTTTCCTTTATGTTAAATTATGATCTTCC
GTATTAATCGTAAGATTGTGAAGACCTTTTTTTGCGTTAA
GTTTCAACAGTTAATATATTATACTGCAATGACATTTTGT
AACTACGTTTTGATTTATTTTTAAAGTGAAACTTAATTTA
AAATGAGAATGCAAAGAGGATTTTTTTGCATTTTATTTAT
TATTTTCCTCCCTGATGTTGGACTGCAGTTTCAGGATGTT
TATGCCTCTATAATCCTTTATTATTTGGCTCCGACCGTCT
AGAATGTAAACAGACTTGTCTTGACAATAACAGTCCTGTG
CCTGTGATTTTTATAAATCTCATGTTTAGACTGGGATCCT
CTCATCAAGACTCAATTCAGTATGAACAAATCGTAGACAG
TAAATGCATTATAGTGCCAATCTCACGACCCCCGCGGTGG
TCCAAACCTCTGATCGCAACATTCTGATCCGACATGTCTA
AAACAGACGGTTTATAAGGGAATTGTTAAATATGCATTTG
TGTATTTATTTCGCCCGTTTTAAACCATGATGTGTTCACC
AGTAAGCATGTGTTTTTTTGATTTGTTATGACTCAAAATT
CGTATTTATTTACAGATTTTGGACCACTTCTACTTTCCAA
GTGCCTAACAGTACATTCCGAGAGTCTTGTACCTTTTAGG
ATTGTAATCCAGAGTCGTTATTTAGATTTTAGCAGGAATT
CAAGGTTAACAGGATTGACATTGACAGAACTACAGTTGAA
TGTGTCCTATGTTTGCAGCTATTGCTGTTCACAACAATAT
GTTTTCTTTTGTAACGACAGATTGCAGTTTAAACCAATAA
AAATATCTATTTATAAGCTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations