Transcript

mir24-001

ID
ZDB-TSCRIPT-090929-23402
Name
mir24-001
Previous Names
None
Transcript Type
miRNA
Annotation Status
miRBASE
Associated With Genes
Strain
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Target Genes
Confirmed Targets
Sequence
MIMAT0001792 (1) [ Show ] (double-click sequence to select) [Download]
>lcl|MIMAT0001792|ZDB-TSCRIPT-090929-23402 LoadedMicroRNAMature mir24-001 miRNA 22bp
TGGCTCAGTTCAGCAGGAACAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations