Transcript

si:ch211-282j17.8-202

ID
ZDB-TSCRIPT-090929-2336
Name
si:ch211-282j17.8-202
Previous Names
  • si:ch211-282j17.8-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000012860 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000012860|OTTDARG00000011075|ZDB-GENE-041210-290 si:ch211-282j17.8|OTTDARP00000011042 CH211-282J17.8-001 LG_ CR392330.9 Danio rerio protein_coding NOVEL, 1524 bp
CAGATGAGAGCAGATCTAGAATAATCATATAGTCTGAAGC
TGCAGACAGAAACAGCAGACTGAGGACAGAAACACACCAG
CTCTGAGAAATGGCTCTATATTCCTCTCTTCTTCTGATTG
CTCTCTGCTCCATATCTGAATGTGTTCAGCGTCAGTATCA
CTTTATAAATGAGGAGAAGAACTGGACTGAAGCTCAGAGA
TACTGCAGAGAGAAATACACAGATCTGGCCACTGTTGATA
ACATGAACGACACTATTGAGCTGATGAAGAGTGTGAATGA
TGTACGTGATCAGTATGTCTGGATTGGTCTTCAGAAGATG
CGTGTTTATAATTGGCATTGGTCTTCAGGTGATCCTTTGC
TCTTTCTGAACTGGATGTCTGGACAACCACCTAGCAGTAA
TGAGTGTACTGTTATGATTAATGGACAGTGGATTATTGAG
GCATGTAGTAACACTCGTGTCTTCATCTGCTACAACATGA
GCGGAGGACTGGTGTTTGTCAGTCAGTTGATGAACTGGAG
AGCCGCTCAGAGTTACTGCAGACAGAATCACACTGATCTG
GTCAGTGTGAGGAACCAGAATGAGAATCAACAGCTGGAGC
AGTTCATTAATGACCGAAGCTTATCTGGATCTCCAGTCTG
GATCGGTCTGTTCAGAGACACATGGCAGTGGTCAGATCAG
AGCAACTCCTCATTCAGATACTGGGCTGATACTTTTAGAG
ATTTTACAGGATGTGCAGCGATTCAACCAAACACACAGGG
ACGATGGGCTGACTACTCTAATTTTCACCAGTTTCCTTTT
GTGTGTCATGAAGATAAACTGATTGTGATCCAGCAGAATC
TGTCGTGGTCTGAAGCTCTGAGATACTGCAGACAGAATCA
TGTGGATCTGGTCTCGGTTCAGTCAGTGGAGATGCAGTAT
GAGGTGATGAACGTGGTTAAACTGGCGTCTACTGAGGCGG
TGTGGTTGGGTTTACACAACTACTGCAGCATGAACATGTG
GCTCTGGCTGAGTGGAGACATGGTGTGCTATCAGAACTGG
GCTCCAGGGAACAGCAGCACACCGGAAAACTGCAAACTGG
AGAACAGAAAAGGAGCAGTTCAGTCTGAAGGAGATCAGAC
CTGGATCAGCCTTCCTGAATCTCACAGACTCAACTTCATC
TGCACTAACTACTGAGAGTGAGAAAAGATGAGATTGTCAG
TGTGTTTATTAACGTTCATTGTTCTGATTTACTTTTATTA
TAGGTTTGGTTTGTTTCTTAGGTTCTGAGTGAATCTGCTA
TATGTGCTTTAACAGCCACAATAGTCTGTTTTATTTCTGT
ATTTTATCATGATATTATCTGCTTTTATTAACACCAATGC
TTCTGATTCAGATTTAATATACTTTAGATGTGATAAGTAT
GTTTAGACACACTCTTCTATATCTGGTGGTGTTTGTTGTT
GTTTTGCATATATAATGTCTATTTGAATGTGTTTCTGTGA
GCACCATTACTGGAGAAAACATCATGAGTCTCAGGAGAAT
GAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations