Transcript

si:ch211-282j17.7-001

ID
ZDB-TSCRIPT-090929-2334
Name
si:ch211-282j17.7-001
Previous Names
None
Transcript Type
pseudogenic transcript
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000012858 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000012858|OTTDARG00000011074|ZDB-GENE-041210-289 si:ch211-282j17.7|no_translation CH211-282J17.7-001 LG_ CR392330.9 Danio rerio unprocessed_pseudogene none, 945 bp
ATGAACGACACTATAGAGCTAATTAAGCCTGTGAATAAAG
CACGTGCTCAGAATATCTGGATTGGTCTTCGGAAGACGAG
TGTTTATACTTGGCATTGGTCTTCAGGTGATACTGTGCTC
TTTCTGAACTGGGCATCTGGACAACCAGCCAGCAGTAATA
ATTGTACTGTTATGAGAAACGGACATTGGTTTGATTGGTC
ATGTAGTGCCACCTGTTTCTTCATTTGCTACAACACAAAC
TCAGGACTGGTGTTTGTCAATCAGACGATGAACTGGAGAG
ACGCTCAGAGTTACTGCAGACAGAATCACATTGATCTGGT
CAGTGTGAGGAACCAGAATGAGAGTCAACAGCTGGAGAAG
TTCATTAATGACAGAAACTCATCTGGATCTGCAGTCTGGA
TCGGTCTGTTCAGAGACACATGGCAGTGGTCAGATCACAG
CAACTCCTCATTCAGATACTGGAACACTGCTGAACCAAAT
AACTATGGCGGTGATGAAAACTGTTCAGTGATTGAAACGA
ATGCTCAGAGAGGATGGGCAGACAACCCTTGTCATTACCA
GTTTCCTTTTGTGTGTCATGAAGATAAACTGATTGTGATC
CAGCAGAATCTGTCATGGTCTGAAGCTCTGAGATACTGCA
GACAGAATCATGTGGATCTGGTCTCGGTTCAGTCAGTGGA
GATGCAGCGTCGTGTGATGAACGTGGTTAAACTGGCGTCT
ACTGAGGCGGTGTGGTTGGGTTTACACAACTACTGCAGCA
TGAACATGTGGCTCTGGGTGAATGGAGACATGGTGTGCTA
TCAGAACTGGGCTCCAGGGAACGGCAGCACACCGGAAAAC
TGCAAACTGGAGAACAGAAAAGGAGCAGTTCAGTCTGGAG
GAGATCAGACCTGGATCAGCCTTCCTGAATCTCACACACT
CAACTTCATCTGCACTAACTACTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations