ZFIN ID: ZDB-TSCRIPT-090929-2334
Transcript Name: si:ch211-282j17.7-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: pseudogenic transcript
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000012858 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000012858|OTTDARG00000011074|ZDB-GENE-041210-289 si:ch211-282j17.7|no_translation CH211-282J17.7-001 LG_ CR392330.9 Danio rerio unprocessed_pseudogene none, 945 bp
ATGAACGACACTATAGAGCTAATTAAGCCTGTGAATAAAG
CACGTGCTCAGAATATCTGGATTGGTCTTCGGAAGACGAG
TGTTTATACTTGGCATTGGTCTTCAGGTGATACTGTGCTC
TTTCTGAACTGGGCATCTGGACAACCAGCCAGCAGTAATA
ATTGTACTGTTATGAGAAACGGACATTGGTTTGATTGGTC
ATGTAGTGCCACCTGTTTCTTCATTTGCTACAACACAAAC
TCAGGACTGGTGTTTGTCAATCAGACGATGAACTGGAGAG
ACGCTCAGAGTTACTGCAGACAGAATCACATTGATCTGGT
CAGTGTGAGGAACCAGAATGAGAGTCAACAGCTGGAGAAG
TTCATTAATGACAGAAACTCATCTGGATCTGCAGTCTGGA
TCGGTCTGTTCAGAGACACATGGCAGTGGTCAGATCACAG
CAACTCCTCATTCAGATACTGGAACACTGCTGAACCAAAT
AACTATGGCGGTGATGAAAACTGTTCAGTGATTGAAACGA
ATGCTCAGAGAGGATGGGCAGACAACCCTTGTCATTACCA
GTTTCCTTTTGTGTGTCATGAAGATAAACTGATTGTGATC
CAGCAGAATCTGTCATGGTCTGAAGCTCTGAGATACTGCA
GACAGAATCATGTGGATCTGGTCTCGGTTCAGTCAGTGGA
GATGCAGCGTCGTGTGATGAACGTGGTTAAACTGGCGTCT
ACTGAGGCGGTGTGGTTGGGTTTACACAACTACTGCAGCA
TGAACATGTGGCTCTGGGTGAATGGAGACATGGTGTGCTA
TCAGAACTGGGCTCCAGGGAACGGCAGCACACCGGAAAAC
TGCAAACTGGAGAACAGAAAAGGAGCAGTTCAGTCTGGAG
GAGATCAGACCTGGATCAGCCTTCCTGAATCTCACACACT
CAACTTCATCTGCACTAACTACTGA

si:ch211-282j17.7 TRANSCRIPTS
Type Name Length (nt) Analysis
pseudogenic transcript si:ch211-282j17.7-001 945
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-282j17.7-001 Contained in:
[BAC] CH211-282J17 (1)

Genome Resources: Vega_Trans:OTTDART00000012858 (1),  Ensembl_Trans:ENSDART00000135862 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CA472374 (1) 895 nt
GenBank:EE684766 (1) 884 nt
GenBank:CN022314 (1) 832 nt
GenBank:BQ259957 (1) 613 nt
CITATIONS (2)