Transcript

si:ch211-282j17.3-002

ID
ZDB-TSCRIPT-090929-2331
Name
si:ch211-282j17.3-002
Previous Names
None
Transcript Type
mRNA
Annotation Status
Withdrawn by Sanger
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
None
RNACentral
Note
None
Sequence
OTTDART00000012853 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000012853|OTTDARG00000011070|ZDB-GENE-041210-287 si:ch211-282j17.3|OTTDARP00000011035 CH211-282J17.3-002 LG_ CR392330.9 Danio rerio protein_coding NOVEL, 891 bp
GGACAGAAACACACCACCTCTGAGGTAAGAACAACTCACA
TATACATTACCCACACACACACACTTCTGACATCTAAATG
GCTCAAACTCTATATTCCTCTCTTCTCCTCATTGCTCTCT
GCTCCATATCTGAATGTGTTCAGCATCAATATTACTATAT
AAATGTGAACAAGACCTGGACTGAAGCTCAGAGATACTGC
AGAGAGAAATACACAGATCTGGCTACCATTGACAACATGA
ATGAATTAAACAACATGAACAAGCTGGTGAAGAGTGAGAA
TAATGGAGCTACTGAATATGTCTGGACTGGTCTTCAGAGG
ATGAGTGTTTATAAATGGCATTGGTCTTCAGGTGATCCTG
CGCTCCTTCTGAACTGGGCATCTGGACAACCAGCCGGCAG
TGATGATTGCGCTGTTATGAGAAATGGACAGTGGTTTGAT
GAGCCATGTAGTAAAACTTGGATTTTTATCTGCTATAACA
ATAAACTGATTGTGATCCAGCAGAATCTGTCGTGGTCTGA
AGCTCTGAGATACTGCAGACAGAATCATGTGGATCTGGTC
TCGGTTCAGTCAGTGGAGATGCAGCGTCGTGTGATGAACG
TGGTTAAACTGGCGTCTACTGAGGCGGTGTGGTTGGGTTT
ACACAACTACTGCAGCATGAACATGTGGCTCTGGGTGAAT
GGAGACATGGTGTGCTATCAGAACTGGGCTCCAGGGAACG
GCAGCACACCGGAAAACTGCAAACTGGAGAACAGAAAAGG
AGCAGTTCAGTCTGGAGGAGATCAGACCTGGATCAGCCTT
CCTGAATCGCACAGACTCAACTTCATCTGCACTAACTACT
GAGAGTGAAAAAAATATGAGATTATCAGTGTCCAGTTCTG
TGTTGTTGTGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations