ZFIN ID: ZDB-TSCRIPT-090929-2330
Transcript Name: si:ch211-282j17.3-201
Previous Name: si:ch211-282j17.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000012852 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000012852|OTTDARG00000011070|ZDB-GENE-041210-287 si:ch211-282j17.3|OTTDARP00000011034 CH211-282J17.3-001 LG_ CR392330.9 Danio rerio protein_coding NOVEL, 1208 bp
AGACAGAAACATCAGACTGAGGACAGAAACACACCACCTC
TGAGAAATGGCTCAAACTCTATATTCCTCTCTTCTCCTCA
TTGCTCTCTGCTCCATATCTGAATGTGTTCAGCATCAATA
TTACTATATAAATGTGAACAAGACCTGGACTGAAGCTCAG
AGATACTGCAGAGAGAAATACACAGATCTGGCTACCATTG
ACAACATGAATGAATTAAACAACATGAACAAGCTGGTGAA
GAGTGAGAATAATGGAGCTACTGAATATGTCTGGACTGGT
CTTCAGAGGATGAGTGTTTATAAATGGCATTGGTCTTCAG
GTGATCCTGCGCTCCTTCTGAACTGGGCATCTGGACAACC
AGCCGGCAGTGATGATTGCGCTGTTATGAGAAATGGACAG
TGGTTTGATGAGCCATGTAGTAAAACTTGGATTTTTATCT
GCTATAACACAAACACAGGACTGGTGTTCGTTGATCAGCT
GATGAACTGGAGAGCCGCTCAGAGTTACTGCAGACAGAAT
CACATTGATCTGGTCAGTGTGAGGAACCAGAATGAGAGTC
AACAGCTGGAGAAGTTCATTAATGACAGAAACTCATCTGG
ATCTGCAGTCTGGATCGGTCTGTTCAGAGACACATGGCAG
TGGTCAGATCAGAGCAACTCCTCATTCAGATACTGGAACA
CTGCTGAACCAAACAATGCTGGAGGTATTCAAAACTGCAT
CGGAATGAATCAGAATGCACAGGGACGATGGCATGACATC
TCGTGCACCGGCTCATTTCCTTTTGTGTGTCATGAAGATA
AACTGATTGTGATCCAGCAGAATCTGTCGTGGTCTGAAGC
TCTGAGATACTGCAGACAGAATCATGTGGATCTGGTCTCG
GTTCAGTCAGTGGAGATGCAGCGTCGTGTGATGAACGTGG
TTAAACTGGCGTCTACTGAGGCGGTGTGGTTGGGTTTACA
CAACTACTGCAGCATGAACATGTGGCTCTGGGTGAATGGA
GACATGGTGTGCTATCAGAACTGGGCTCCAGGGAACGGCA
GCACACCGGAAAACTGCAAACTGGAGAACAGAAAAGGAGC
AGTTCAGTCTGGAGGAGATCAGACCTGGATCAGCCTTCCT
GAATCGCACAGACTCAACTTCATCTGCACTAACTACTGAG
AGTGAAAAAAATATGAGATTATCAGTGTCCAGTTCTGTGT
TGTTGTGT

si:ch211-282j17.3 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA si:ch211-282j17.3-201 1208
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-282j17.3-201 Contained in:
[BAC] CH211-282J17 (1)

Genome Resources: Vega_Trans:OTTDART00000012852 (1),  Ensembl_Trans:ENSDART00000142591 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CN022314 (1) 832 nt
GenBank:BQ259957 (1) 613 nt
CITATIONS (2)