ZFIN ID: ZDB-TSCRIPT-090929-2327
Transcript Name: si:ch211-282j17.1-201
Previous Name: si:ch211-282j17.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000012849 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000012849|OTTDARG00000011068|ZDB-GENE-041210-285 si:ch211-282j17.1|OTTDARP00000011031 CH211-282J17.1-001 LG_none BX005456.6,CR392330.9 Danio rerio protein_coding NOVEL, 1142 bp
AAAACATCAGACTGAGGACAGAAACACACCAGCGCTGAGA
AATGGCTCAATCTCTATATTTCTCTCTTCTCCTCATTGCT
CTCTGCTCCATATCTGAATGTGTTCAGCATCAATATTACT
ATATAAATGTGAACAAGAACTGGACTGAAGCTCAGAGATA
CTGCAGAGAGAAATACACAGATCTGGCCACTGTTGACAAC
ATGAATGACATGATCCAGCTGAACAAGATTGTAAATAATG
TACGTGTCTGGATTGGTCTTCAAGAGACGAGGGTTTATAA
TTGGCATTGGTCTTCAGGTGATCCTGCGCTCTTTCTGAAC
TGGGCATCTGGACAACCAGTTGGCAATGATGAATGTACTT
TTATGAGAAACGAGCAGTGGATTGTTGGGCCATGTAAAAA
CACTTGTTTCTTCATCTGCTACAACATGAGCCCAGGACTG
GTGTTTGTCAATCAGACGATGAACTGGAGAGATGCTCAGA
GTTACTGCAGACAGAATCACATTGATCTGGTCAGTGTGAG
GAACCAGAATGAGAGTCAACAGCTGGAGAAGTTCATTGAT
GACAGAAACTCATCTGGATCTGCAGTCTGGATCGGTCTGT
TCAGAGACACATGGCAGTGGTCAGATCAGAGCAGCTCCTC
ATTCAGATACTGGAAAACCAGTGAACCAAATAATTATGCA
GGTCCGGAAAACTGTACAGTGATTGAACGGAATGCTCAGG
GCCGATGGTCAGACTACCTTTGTCACCACCAGTTTCCTTT
TGTGTGTCATGAAGATAAACTGATTGTGATCCAGCAGAAT
CTGTCGTGGTCTGAAGCTCTGAGATACTGCAGACAGAATC
ATGTGGATCTGGTCTCGGTTCAGTCAGTGGAGATGCAGCG
TCGTGTGATGAACGTGGTTAAACTGGCGTCTACTGAGGCG
GTGTGGTTGGGTTTACACAACTACTGCAGCATGAACATGT
GGCTCTGGGTCAGTGGAGACATTCTCTGCTATCAGAACTG
GGCTCCAGGAAACACAACACACAGCAGCACACCGGAAAAC
TGCAAAATGGAGAACAGAAGAGGAGCAGTTCAGTCTGGAG
GAGATTATTGTTGGATCAGCCTTCCTGAATCTCACAGACT
CAACTTCATCTGCACTAACTAG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-282j17.1-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000012849 (1),  Ensembl_Trans:ENSDART00000064280 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CN022314 (1) 832 nt
CITATIONS (2)