ZFIN ID: ZDB-TSCRIPT-090929-2325
Transcript Name: si:ch211-282j17.11-202
Previous Name: si:ch211-282j17.11-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000012847 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000012847|OTTDARG00000011067|ZDB-GENE-041210-284 si:ch211-282j17.11|OTTDARP00000011029 CH211-282J17.11-001 LG_ CR392330.9 Danio rerio protein_coding NOVEL, 1151 bp
AAAAACACCAGACTGAGGACAGAAACACACCAGCTCTGAA
AAATGGCTCAGACTCTATATCTCTCTCTTCTCCTCATTGC
TCTCTGCTCCATATCTGAATGTGTTCAGCGTCAGTATCAC
TTTATCAATGAGAACAAGACCTGGACTGAAGCTCAGAGAT
ACTGCAGAGAGAAATACACAGATCTGGCCACCGTTGACAA
CATGAACGACATGATCCAGCTGAAGAAGAGTGTGAAAGTG
AATGATGGATATGCCTGGATTGGTCTTCAGAAGATGAGTG
TTTATAAATGGCATTGGTCTTCAGGTGATCCTGTGCTCTT
TCTGAACTGGGCATCTGGACAACCAGCTGAAGGTGATAAT
TGTACTGTTATGAGAAATGGAAAGTGGTTTGTTGCACCAT
ATAGTGACGCCTGGACTTTCATCTGCTACAACATGAGGAC
AGGACTGGTGTTTGTCAATCAGATGATGACCTGGAGAGAC
GCTCAGAGTTACTGCAGACAGAATCACATTGATCTGGTCA
GTGTGAGGAACCAGAATGAGAATCAACAGCTGGAGAAGTT
CATTAATGACAGAAACTCATCTGGATCTGCAGTCTGGATC
GGTCTGTTCAGAGACACATGGCAGTGGTCAGATCAGAGCA
ACTCCTCATTCAGATACTGGGATACTACTCAACCTGATAA
TCAAGGAGGCATTGAAAACTGTGTAGGAATAAGTCTGTAT
GTTCAGGGAAAATGGCATGACATCTCCTGCACCAGCTCAT
TTCCTTTTGTGTGTCATGAAGATAAACTGATTGTGATCCA
GCAGAATCTGTCGTGGTCTGAAGCTCTGAGACACTGCAGA
CAGAATCATGTGGATCTGGTCTCGGTTCAGTCAGTGGAGA
TGCAGCGTCGTGTGATGAACGTGGTTAAACTGGCGTCTAC
TGAGGCGGTGTGGTTGGGTTTACACAATTTCTGCAGCGTA
AACATGTGGCTCTGGCTGAGTGGAGACATGGTGTGCTATC
AGAACTGGGCTCCAGGGAACGGCAGCACACCGGAAAACTG
CAAACTGGAGAACAGAAAAGGAGCAGTTCAGTCTGGAGGA
GATCAGACCTGGATCAGCCTTCCTGAATCTCACAGACTCA
ATTTCATCTGCACTAACCACTGAGAGAAGAT

si:ch211-282j17.11 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA si:ch211-282j17.11-202 1151
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-282j17.11-202 Contained in:
[BAC] CH211-282J17 (1)

Genome Resources: Vega_Trans:OTTDART00000012847 (1),  Ensembl_Trans:ENSDART00000137140 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC171481 (1) 1271 nt
GenBank:CA472374 (1) 895 nt
GenBank:CN022314 (1) 832 nt
GenBank:CF997417 (1) 765 nt
GenBank:BQ259957 (1) 613 nt
CITATIONS (2)