Transcript

si:busm1-sl7.7-001

ID
ZDB-TSCRIPT-090929-23238
Name
si:busm1-sl7.7-001
Previous Names
None
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
AB
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000002193 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000002193|OTTDARG00000002047|ZDB-GENE-041001-38 si:busm1-sl7.7|OTTDARP00000001943 BUSM1-SL7.7-001 LG_ AL929301.6 Danio rerio protein_coding NOVEL, 1013 bp
AATCCTCTACCACGTTGCGTCTTGGCAAGTCATCTGATGT
GCGTCAAGGTGAATTTGTGGTTGCCATGGGGAGCCCCTTT
TCTCTTAAAAACACCATCACATCTGGAATCGTCAGCTCTG
CTCAGAGAGACAGTAAAGAACTGGGTCTCTCCAACTCCAA
CATGGACTACATCCAGACGGACGCTACCATAGATTTTGGA
AATTCAGGAGGGCCTCTCATAAACCTGGATGGTGAGGTCA
TCGGCATTAATACCATGAAAGTGACAGCAGGGATTTCCTT
CGCTATTCCCTCAGACAGAGTCCGTCTCTTCCTAGACCGA
TCTGCAGACAAACAGAGTAAGAATGACCTCACAGCTTCTT
GGTTTGGAGAATTGGGATCGAAAAGGCGTTACATTGGAGT
GATGATGTTGACTTTGACCCCCAGTATAATCGAAGAGCTA
AGGATGCGAGACCCGTCCTTCCCTGATGTTTCTCATGGAG
TTTTCATCCACCGTGTGATTGTATGATCTCCAGCCAACAG
AGCCGGAATGAAGCCAGGAGATGTTATTATTGAGATCAAT
GGGGTAAAGGTGAACACGTCGTAGGAGATATATAATGCTG
TGAGGACCAGCGAAAGCTTAAATGTGGTGGTCCGCCGGGG
GGCCGACCTGCTCATGCTGCACATGACCCCAGAGTCCACA
GAGTGACATCAAGTCAAGTATTTAGTAAGATTAAGAAATG
GTGAGTAATGAGAAGCTGTCATAGTTGGAGATGTTGTAAG
AAAGGAATCATCTAAAGAGTTGAACAGTTGTAGCAAACGC
TGGACATTCGTGTAGTAAACGTGTTTCTGGAAGCGTATGA
AATAATGTGGATGATTCAGACTTCTGTACACTGGATAAAC
CTCAGCGTGTCTGCGCAAACTACACTATCAGTATTGATTT
GAAGGAATATCACTGAATATTTTGTTTAGGATTGTCATGA
TGGCAACAAACACTCAAAGACCTTAATAAAACTGGGTGCT
CTTATTGTGAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations