Transcript

si:ch211-282j17.10-201

ID
ZDB-TSCRIPT-090929-2323
Name
si:ch211-282j17.10-201
Previous Names
  • si:ch211-282j17.10-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000012845 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000012845|OTTDARG00000011066|ZDB-GENE-041210-283 si:ch211-282j17.10|OTTDARP00000011027 CH211-282J17.10-001 LG_ CR392330.9 Danio rerio protein_coding NOVEL, 1166 bp
AGACAGAAACATCAGACTGAGGACAGAAACACACCAGCTC
TGAGAAATGGCCAAACCACTAAATTTCCCTCTTCTCCTCA
TTGCTCTCTGCTCCATATCTGAAAGTGTTCAGCATCAATA
TCATTTTATAAATGAGAAGAAGAATTGTACTGAAGCTCAG
AGATACTGCAGAGAGAAATACAAAGATCTGGCCACCGTTG
ACAACATGAACGACACTATTGAGCTAATTAAGTCTGTGAA
TAATGCACGTGTTCAGAATATCTGGATTGGTCTTCAGAGA
ACGAGTGTTTATAAATGGCATTGGTCTTCAGGTGATCCTG
TGTTCTTCCTAAATTGGACGTCTGAAGAACCAGCTGGCAA
TAATGAGTGTACTGTTATGAATAATGGACAGTGGATTAAT
GAGGCATGTAATAACACTCGTGTCTTCGTCTGCTACAACA
TGAGCAGAGGACTGGTGTTTGTCAATCAGATGATGACCTG
GAGAGACGCTCAGAGTTACTGCAGACAGAATCACATTGAT
CTGGTCAGTGTGAGGAACCAGAATGAGAATCAACAGCTGG
AGAAGTTCATTAATGACAGAAACTCATCTGGATCTGCAGT
CTGGATCGGTCTGTTCAGAGACTCATGGCAGTGGTCAGAT
CAGAGCAACTCCTCATTCAGATACTGGGATACTGGTGAAC
CAAATAATGGTGGGGAGTATGATAACTGTACAGTGATTGG
GGCGAATGCTCAGAGAGGATGGGCAGACGTCCCTTGTGAT
AACCGCCAAATTCCTTTTGTGTGTCATGAAGATAAACTGA
TTGTGATCCAGCAGAATCTGTCGTGGTCTGAAGCTCTGAG
ATACTGCAGACAGAATCATGTGGATCTGGTCTCGGTTCAG
TCAGTGGAGATGCAGCGTCGTGTGATGAACGTGGTTAAAC
TGGCGTCTACTGAGGCGGTGTGGTTGGGTTTACACAACTT
CTGCAGCGTGAACATGTGGCTCTGGGTGAATGGAGACATG
GTGTGCTATCAGAACTGGGCTCCAGGGAACGGCAGCACAC
CGGAAAACTGCAAACTGGAGAACAGGAAAGGAGCAGTTCA
GTCTGGAGGAGATCAGACCTGGATCAGCCTTCCTGAATCT
CACAGACTCAACTTCATCTGCACTAACTACTGAGAGTGAG
AAAAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations