ZFIN ID: ZDB-TSCRIPT-090929-23207
Transcript Name: skap1-001
Previous Names: skap2-001, dZ227H09.6-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status: fragmented
Strain: AB
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000001800 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000001800|OTTDARG00000001686|ZDB-GENE-090721-1 skap1|OTTDARP00000001587 BUSM1-227H09.6-001 LG_ AL645798.2 Danio rerio protein_coding NOVEL, 497 bp
AGATCCCTCTGGTGGCTGCACAAGACCTGAGTAACATTCT
GAAGCAAGGTTACCTGGAAAAAAAGAGACGAGATCACAGT
TTCTTCAGCATGGAATGGCAAAAGCGATGGTGTGTTCTGA
ACAACACCATATTTTATTACTTCGGGAGTGATAAAGACAA
GCAGCAGAAGGGCTCGTTTTATATCAATGGTTACAGTGCA
GAGTTGGTTCCCAGTTTACGCAAAGACTCCAAGAAGAGCT
CCTGCTTTGAGATGAGTGCTCCTGGAAGACGCTCTTACCA
GTTCACTGCCAGCAGTCCTCGTGAAGCAAGAGAATGGGTG
GACCAGATCAATTTTGTTCTTAAGGATGATGAAAATTCTG
ACAACGCTGAAGATTGCAGTGAGAGAACTGGGTCCTCCGA
TTATGCCAATTATTACCAAGGCTTGTGGGATTGTGAAGCT
GAGGGACCGGACGAGTTGGCCTTCCAGAGAGGAGATTTGA
TCTACATTCTCAGCAAG

skap1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA skap1-001 497
ncRNA skap1-002 (1) 744
mRNA skap1-202 (1) 3020
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
skap1-001 Contained in:
OTHER skap1-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000001800 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCESNo data available
    CITATIONS (1)