Transcript

ottdart00000001606

ID
ZDB-TSCRIPT-090929-23182
Name
ottdart00000001606
Previous Names
None
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
AB
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000001606 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000001606|OTTDARG00000001495|ZDB-GENE-141212-19 si:ch211-96i7.3|OTTDARP00000001412 BUSM1-40G1.3-001 LG_ AL591674.3 Danio rerio protein_coding NOVEL, 353 bp
ATGGCGCTCTGCTACAGTGATATACTTCTCATGACAGCTT
TTATCCTAGGATGCAAAGCACAGGACAATGTATTACAGCC
CAAACAAGTTATGACAGCTTATGAAGATGGAACAATCACT
CTTGAGTGCACGTACAAAGCGTCCAGCACTCAATATCCAA
ACCTCCTCTGGTACCAACAGATGACGAATGGATCCCCAAA
ATACATGCTGATGAGACTTTCTGGATCTAGTGACACTAAT
GAAGAGTTTAAGCAGAGATTTAACGCAGAACTCAACACAT
CTGCATTATCAATTCCTCTGACAATCAAGGATCTGCGTGC
ATCAGATTCTGCTGTGTATTACTGTGCCCTGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations