Transcript

naa10-201

ID
ZDB-TSCRIPT-090929-23081
Name
naa10-201
Previous Names
  • ard1a-001
  • naa10-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000026948 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000026948|OTTDARG00000030556|ZDB-GENE-040426-2648 naa10|OTTDARP00000022088 ard1a-001 LG_ BX897727.17 Danio rerio protein_coding KNOWN, 974 bp
ATACGTCTTCCTGTCATGGACAACATGGTTGTTGAGGTGT
AGCTGTGTCCATCTGCGTGCTTTTTGGCTTCGGTTGAAGA
TCTTTTGCCTATTTGACACCTGTATTTATATTATATAGCA
TATTTATCAAACAGGTCAGCGGTCAACATGAATATACGCA
ACGCACGGCCAGAGGATCTGATGAACATGCAGCACTGTAA
CCTGCTGTGTCTTCCAGAGAACTATCAGATGAAGTACTAC
TTCTACCATGGCCTGTCCTGGCCTCAGCTGTCCTACATCG
CAGAGGATGAGAACGGGAAGATAGTGGGATATGTTCTGGC
AAAAATGGAGGAGGATCCTGACGATGTGCCTCATGGACAC
ATTACTTCACTGGCAGTTAAACGCTCACACAGGCGTCTTG
GACTGGCTCAAAAACTGATGGATCAAGCCAGCAGAGCCAT
GATTGAGAACTTCAATGCCAAATATGTCTCTTTACATGTC
AGGAAGAGTAATCGGGCTGCTCTTCACTTGTACTCCAACA
CACTTAAGTTTCAGATTAGCGAAGTGGAACCCAAATATTA
TGCCGATGGGGAAGATGCTTACGCCATGAAGAGAAATCTC
ACGCAGATGGCAGATGAGTTGCAGAAGCCAGGTGTGCGTC
TGTGGGGCTCCGAGGCTCCACCGTCTCAGGACACATCTGT
GACGGGCCTGGTGGAGAAGCTGACGGTGCAGGATGGAGAG
AAGGAGGGAGATGGAGACAGCGGAGGAGAGAGTAAAGAAA
TGAGCGAGGTCAGCGAGGCCACCGAAAGCACGGACGTCAA
AGACTCATCGTCAGACTCTTAACTCGCATCCATCACATAG
GTTTCAAATGGGTTTACAGTGTTTATATGCTCTGATGGTT
TATTTTTAAAATACAGGAAAGTGATCTGATAAAAATGGGT
TCTCACCTATGGAGTTATGTGAGAGGAAATTTGACAATAA
AATTGGAGAGTAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations