Transcript

h2afva-201

ID
ZDB-TSCRIPT-090929-23065
Name
h2afva-201
Previous Names
  • h2afv-001
  • h2afva-001
  • ottdart00000019007
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000019007 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000019007|OTTDARG00000015854|ZDB-GENE-020717-1 h2afva|OTTDARP00000016046 h2afz-001 LG_ BX322550.8 Danio rerio protein_coding KNOWN, 831 bp
ATTGTTCCTCCGAGTCAAGAGGCGGATAGGCTGTAGCCAA
ACCTCCCAGGCTCCCATTCAAAGTAATACATCGCTGAAAT
GGCAGGTGGAAAAGCAGGTAAAGACAGTGGCAAAGCCAAG
GCGAAAGCAGTGTCTCGCTCGCAAAGAGCTGGTCTTCAGT
TTCCAGTGGGACGAATCCACAGGCACTTGAAGACACGCAC
TACAAGCCATGGTCGAGTAGGAGCAACAGCAGCCGTTTAC
AGCGCAGCCATTCTTGAATATCTCACAGCTGAAGTTTTGG
AGTTGGCAGGAAATGCTTCAAAAGACCTGAAGGTGAAGCG
CATCACTCCTCGACATTTACAGCTGGCCATTCGAGGAGAT
GAGGAGCTCGATTCCCTTATCAAGGCCACTATTGCTGGAG
GAGGTGTGATTCCACACATCCACAAGTCTCTGATTGGTAA
GAAGGGCCAGCAGAAAACCGCATAGTTCCCATCAGGATCT
AAGTGCAGACATGACTCAAGGACTTGCATTTGGGATGTGA
ATCGATAAGCTTGTGTTCATCCTTTAATCCATTTTTTTTT
TTCCCCCATCCCTTATTTTTAAGTTAATATAAATGTTATA
CTAGCTAACCACAGGTGTTTTTGTTAGTTTTGTGTTAATG
TTATATATAAATATCGCCAAATTAGAATGGCAAATAATCC
CCGTCCCACTGAAGCCAGGTGTTTTAGAGACCAACAGGAA
GTGTCTGATCTTTCCTGCCATGACTGTGGAAGTGTTTGTT
CAATTGGCCAGAGCCGTGGAGCTGTTTTATACTGAAGTGC
AAATGATAAACTTTTTATATAAAACCAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations