ZFIN ID: ZDB-TSCRIPT-090929-23043
Transcript Name: nap1l4b-201
Previous Name: nap1l4b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028299 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028299|OTTDARG00000022060|ZDB-GENE-041114-168 nap1l4b|OTTDARP00000023140 ZFOS-855G9.1-001 LG_ CR925783.4 Danio rerio protein_coding KNOWN, 3266 bp
AATATTTGAGCTGTAGTATCAAGATGGAGGCTGACAATGA
AGCCAAAGGTAAGGTGAGTGACCAGGCAATGCAGAACCCA
CAGGCGTTGGCAGCTCTTCAGGACAAATTAGACAGTGTCT
CACATAGTGCTTCCATCATGGACAGCTTACCAAAGTCTGT
GAAAAGAAGAGTCAATGCCTTAAGGAATCTTCAGGTTAAC
AGCACGCACATCGAAGCCAAGTTTTACAAAGAGGTGCACG
AGCTGGAGAGAAAGTACAGCGCTCTTTACCAGCCACTGTT
TGACAAAAGAAGAAAGGTTGTCTCTGGAGAAGTGGAGCCC
ACTGATGAGGAGTGTGAATGGCAGAGCGACCATGAGGATG
AAGCAGCATTAGCAGAAGACCTGAAGAAGAAAGCTGCTAT
AGAGGAAAAGACGGAAGATGCTAATGAGGAGAAACCTAAG
GGAATTCCAGAGTTCTGGCTCACCATCTTCCGCAGTGTGG
ACATGTTGAGTGATATGCTGCAGGAGCATGACGAACCAAT
ACTTAAACATCTTCATGATATTAAAGTGATATTTTCTGGT
CCTGACCAGCCCATGAGCTTCACGTTAGAGTTCCATTTTG
AACCCAATGAATACTTCACCAACACAGTTCTCACAAAGGT
ATACAAGATGAAGTCAGAGCCAGATGCAGATGATCCGTTT
TCCTTTGAGGGACCAGAAATCATTGACTGTGAAGGGTGTG
AAATTGATTGGCAGAAAGGCAAAGATGTCACAGTGAAAAC
GATCAAGAAGAAGCAGAAGCACAAAGGCAGAGGGACAGCG
AGGGTCATCACCAAACAAGTGCCCAACGATTCCTTTTTCA
ACTTTTTCAACCCTATAAAAGTTTCACCAGATAAGGAATT
GGACGAGGATTCAGAGTACACTTTAGCCACAGATTTTGAA
ATCGGTCATTTCTTCAGGGAAAGAATCGTTCCGAGAGCAG
TTCTGTATTTCACAGGAGAGGCTCTGGAGGATGATGAAAG
TTTTGAGGAGGAAGAATTAGATGAGGGTGAAGAGGAGGAC
CAAGATGATGAGGAAGAGGAGGAGGAAGAAGAGGAGGGAG
ATTCAAAGACCGGGGATCCTCAGCCTGCAGAGTGTAAACA
ACAGTAGTTTGGACTGCTCACTCCTGCCCATCAACTCATC
TAGAATCTGCTCTGTAGTGTGTACGGTCTCTGCAGAGCAC
AACATCCAACAAAACAAAACAAAACATGATGCAGTACATT
AGAAAACTTGGGAGTTTTTTTACCTGACAGAATTTGATTA
CTTCAGTTTAATGGATTTAATACAATGTTCTAAATAAATT
GGGCAATTCCACATTACAGTCGGCCTCAGAATGTAGATAC
ATATAAATATAGAAATGTAAAACTATTTTTTAATTCATGA
TGATTTAGGCATGTACAGACTTTGCCGTTGTGTAGCCAAA
CAAGTTGAATTGCATTTTGGTTTAAAGTGCAACCATATAC
GAGCAGGTGAATTTTTAAGCCTGAATTAAAAACAAAAACT
AAACTAAAAAACAAATATGGGATTGTATACTAACTTCCTG
TGCACATGTAACCTTTGTCAAGGTCGCTCGTATTTAACGA
TAGTTTCTCTTCTCATTTTTCAAGTGTTCTGTGTCATGGA
CATAACCATTTTTTACACAGCATATCTATTTATGTACTTT
TGGAACAAAACCGCATGTTTCTGCACTTATTTATTTTATT
GAAGTGACAGTTGCTAGCTAGTTGACCTAGCCCAAAAAAA
AAACTATGTTCACTGATTCCTTTCAGGCATCAGGAGTTTG
TGTTTAATCATATCCGGTATATTTACAATGTGGATGTCTA
ATGTTTGCATCTTAAAGATTATCATTTCGAAAAACTAATT
CCCTGTCACGTTAAATGGATAGTTCACCCAGAAATTGTAT
TTTACTCTTCATTTATTTGCCCACAAGTTTTTCCAAACGT
CTTGTAATAAACACACACACACAAAAAATGTTTTGAAGAA
TGTTTTGTGAAAATGTAAGAACGCCAGTGAAATCCAGAGT
AGAACAAAGGTATGTTGTTTGCTTGCTAACATTCTTCAAA
ACATCTTATTTTTAGTTTTACATTTTGTGGGGGAAAAACG
GCGTGAGGCTGAGTAAATTCAAAGAAGTTTTCATTTTTGG
GTGAACAATCACTTTCAGTAGCTATTGTAATTTTGTTAGT
GTTTAAATCTGCATTACATCCATAATGCTGGAATTGCTCA
ATTTAGATTTTAATGGGATAGTTCACCCAACAATGAAAAT
ACTGTCATCATTTACTCACCTTTGAATTGTTAAAAACCTA
TTTGAGTTTCTTTATTCTGCTGAACACAAAAGAAGAAAGT
TTGGTAACTGGGACCCATTGAGCAACTCATTTTCCCACCC
ATTCTTATTCTTTAAAATATCTTCACTCACACTTTATTTT
GATGGTCCGTTTGTTGAATTTAAGTTATATTGCATCTACA
TCAACTAATTCCCATTAGATTATAAGTAGACTGTTTGGGG
TTAGGGTTAGTGTAAGGTGACGTACTTGCAAAGCTTCTAA
TAGTCAGTTGAATGTCTGTTGTAGGAGCAGTATCAACAGA
TATTAAGCAGACAGCCTACTAATACGCAAATAGACCATCA
AATTAAAGTATTACCATATCTTCTTTTTGTTTTCAACAGG
AAAATGAAACTCACAACAGGTTTAACAACTGATAATAAAT
GATTTTAATTTTTGTGTGAACTATTCCTTTAAGGAATCAA
AAATGACTGCCAATGGTCGCTGAATTCTGAGTGAACCGCA
GATGATTACATGTCCTCATTGACAGGCCGCTTTTTGCAAA
ATACAACATCACATCCCAGAGTCAACTGAATTAACTTATT
TTGTGACTTGATCTCATAGGTTACTCAGGGTTTTTTATGC
CAAGTTGACAGTGTGCGAGTATCCAGCTTCGAGAAAACTG
TTGATATCTAACCTGCTTAATGTTCTCTTTTGTCTTGTAA
AAGAAGGTCATCTTTTCAGATCTAGTTTTAGTTGTTACAG
AGTTATTTATATGAATCTTCTTTTCCATCATTTCGTTATT
GTTTTCAACTCTGTGTCGGTCTTGTGCTTCTCGGTGGATC
CCTGAGAGAATATGTTTCGCTGATGTATGTACTGTACCCA
GTTGATTATAGCCCCTTTTAGCATTTTAAAAATGCTTTTG
CTGTACTGCCCAAGCACTTACTAAAAAGAAAAAGAAAAAA
AACAAGTAAACATGTTCATTGCCAAA

nap1l4b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA nap1l4b-201 3359
nap1l4b-202 (1)    Ensembl 645
nap1l4b-203 (1)    Ensembl 581
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
nap1l4b-201 Contained in:
[BAC] CH211-251J8 (1)
[Fosmid] ZFOS-855G9 (1)

Genome Resources: Vega_Trans:OTTDART00000028299 (1),  Ensembl_Trans:ENSDART00000099748 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC085386 (1) 3293 nt
GenBank:CT733835 (1) 823 nt
GenBank:EB928925 (1) 644 nt
GenBank:EB931923 (1) 573 nt
CITATIONS (2)