Transcript

si:busm1-40g1.2-001

ID
ZDB-TSCRIPT-090929-22894
Name
si:busm1-40g1.2-001
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
AB
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000001605 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000001605|OTTDARG00000001494|ZDB-GENE-030616-473 si:busm1-40g1.2|no_translation BUSM1-40G1.2-001 LG_ AL591674.3 Danio rerio processed_transcript NOVEL, 1130 bp
TACACAGCAAATTCATCAGAGTTAAATTCTCGGTGTTGAA
GCATTTCAGAGTAAAGTGTTGACGTTAAAGAGTTAGATTT
TGATAAATGAATATAATTAGAGTTAGAATTGATTTTATTC
AGTGCGAAATCAAGGAGTTATCTTTTCAACACTTGGTGGT
GTTATTTCCAACATCCGGGAATTCATGCAGCCCCAGTCAC
TGAAGAATTTTCCAGACGCCATTTGCAAACTAGCGAGGGA
ATCCCCGGAGCAGCCTAGCCTACTCTGCCCGGATGCTAAC
GGCAACACAGGACGGTTTCCAAAAGCTCTGGAGAGTTTCT
AAAACATATCTGCCACAGTTCTCTATACAATAACACAAGA
CCCTGTGACGGTGGCTGATTAGAGACGGATGGTGTATTTC
CAGAGTTGGTGAAATGACCAAGCACACCTTCTTGGTCATA
TGTTGTGATAATAATGAAGATTCTATTTGGACCTGAAACA
TCTGCTAGACTCCAGGAAAGGTGGCGTCAATACTGGACCT
GAAAGGGCCTAACAAGTTGAATCTGCTGGGAGAGTCAAGT
TGTGGATCATCATGTAGATTTTCAAAAGTCATGCTGGAGT
CTTCAAGAGTTCTTAGATGAGCATCACCCTATATCCGTGC
ATCAGGAACCACCAGATGAGCGATCAGCAGCTACTACATC
GTCATGGATAAAAAGGTCATCCTGTGGTTGGGAAGCACTT
CATTCACAGGACATGCTTGATGAGATTTCCTAGCTCCAGT
TTGTTTTCACACAAGTTTACAGCATTTATACCTTCATTTA
AACTGCTGTGTTTGATATGGAGGACCAAGGAAACACCAGA
AGTGAAAGATTTGCACGCCAAGTTTAAAATGTAATTTCAT
AAGAAAACTATGCGTTCAGAAGAAAACTATGAGTGACGCT
ATATTGAACTTTCAAATTGCTCTGATGAAACATCAAGTTT
GGACCAAAGGACTGAAACAGCCTTTTTGAGCACTGGTCAT
ATATATTTTGTTGATACTTTCTGTACTAATAAAACATTTA
AAGCATATTTGACATTGTTGCATTTTAAAAACTGAATGAA
TTGTTGAAGTGGTGAATGTTTTCAAATAAAATGTTTTTTC
TTTTGTAATT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations