Transcript

si:busm1-40g1.12-001

ID
ZDB-TSCRIPT-090929-22891
Name
si:busm1-40g1.12-001
Previous Names
None
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
AB
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000001596 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000001596|OTTDARG00000001485|ZDB-GENE-030616-454 si:busm1-40g1.12|OTTDARP00000001403 BUSM1-40G1.12-001 LG_ AL591674.3 Danio rerio protein_coding NOVEL, 341 bp
ATGAAGCTTCATTCACTTATTCTCTTCTGTGCCTCAGCTG
CGGCTGTTTTTGGAAGTGTCATCAGACCAATCAACACAGA
TGTTTTTGTTGAGGAAGGATCAAATGTGACATTATCCTGT
AGTTTTACAGCCTCTGGAGGGTCAGATGATCTCCACTGGT
ACCGTCAGTATGGAACATCAAAACCTGAATTTCTTGTACT
CACCTACAGAACAGCAAAAGAAGCTGAGAAGTCTAAAGTA
GATCCAAGATTTATTTCCAATGTCCCAAAAAGTGAGCATG
TGGATCTGCTGCTCTCCTCTGCGGCAGTATCAGACTCTGC
TGTATATTACTGCGCTCTGAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations