ZFIN ID: ZDB-TSCRIPT-090929-2286
Transcript Name: asap2a-201
Previous Name: asap2a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000012671 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000012671|OTTDARG00000010927|ZDB-GENE-041210-256 asap2a|OTTDARP00000010880 asap2a-001 LG_ CR381585.11 Danio rerio protein_coding KNOWN, 4258 bp
GAATTGCACTGCAAGAGCTGCATCGACCTGGAAGCCTGCA
GCAAAATCCAGCACGACAACCTACACTCCTGTCCCAAAAC
AGAAGAGAAGCACATCACCGCACTGCTTTATTATCAAACG
AGTGGACTAAATTCCTACTTAAACTGGAAGAAGTGAGATC
CGTGAAAGAAAGAGAGGGAAAAAGAGAGAGATTTCCCCGT
CGTACAAGCCGCACTTCAGTGTAGTTGGCTAATGATTTGT
ATTAATTCCCAACTTGTTTTAATCCACCGAGGACAAAACA
CCGCGATGATAAGACTCCAGGACGCTCATGAGAGTTTTAA
TTCGGCGTTTCATCTCTGAATTTCGACATTAAGTGCACCG
CGACCGGCCAAATCAAGGATTAAACACGACATTTGTGGAT
TTCGCCAAAGGAGATACAATGCCTGACCAGATAACAGTGG
CGGAGTTTGTCACGGAGACAAATGAAGATTATAAATCGCC
CACCGCCTCAAACTTCACCACCAGAATGACTCACTGCAGG
AACACAGTATCCGCACTGGAGGAGGCCCTGGATGTGGACC
GCAGTGTCCTTTACAAGATGAAGAAGTCAGTTAAGGCTAT
TTACGCCTCGGGTCTGGCTCATGTGGAGAATGAGGAGCAG
TACACTCAAGCTCTGGAGAAGTTCGGAGAGAACTGTGTGT
ACAGAGATGACCCGGACCTGGGATCAGCCTTCCTGAAGTT
CTCCGTCTTCACCAAGGAGCTCACGGCACTCTTCAAGAAC
CTGTTTCAGAACATGAATAATATCATTACCTTCCCATTGG
ACAGTCTGCTGAAGGGAGATCTGAAAGGGGTTAAAGGGGA
TCTCAAGAAGCCCTTCGATAAAGCCTGGAAAGACTACGAG
ACTAAAGTCTCTAAAATAGAGAAGGAGAAAAAAGAGCACG
CCCGGCAGCACGGAATGATCCGGACGGAGATCAGCGGAGC
AGAGATAGCAGAAGAGATGGAAAAAGAGCGGCGTTTCTTC
CAGCTTCAGATGTGTGAGTACCTCCTCAAAGTCAATGAAA
TCAAGATCAAAAAAGGTGTCGACCTGCTCCAGAATCTCAT
CAAATACTTCCACGCACAGTGCAACTTCTTTCAGGATGGT
CTCAAAGCGGTGGACAACCTCAAACCCTCAATAGAAAAAC
TGGCCACAGACTTGCACTCGATCAAACAGGTACAGGATGA
AGAACGCAGACAGCTAACCCAGTTACGGGATGTGCTAAAA
ACTGCTCTGCAAGTGGAGCAGAAGGAGGACTCTCAGGTTA
GACAGAGCGCCACCTACAGTCTGCACCAGCCGCAGGGCAA
CAAAGAGCATGGGACTGAGCGCAGCGGCAACCTTTACAAG
AAGAGTGACGGGCTGCGGAAAGTGTGGCAGAAGAGAAAGT
GCACAGTAAAGAATGGATATTTGACCATCTCACATGGGAC
GGCAAACAGACCTCCCGCCAAACTCAATCTTCTCACCTGT
CAGGTGAAGCACAACCCAGAGGAGAAGAAAAGTTTTGACC
TCATCTCACATGACAGAACATATCATTTCCAGGCAGAAGA
TGAGCCAGAGTGTCAAATATGGATCTCAGTGCTGCAGAAC
AGTAAAGAAGAGGCGCTCAACAACGCCTTCAAGGGCGACC
AGCATGTTGGTGAAAATAACATTGTGCAGGAGCTCACCAA
GGCCATCCTGGGAGAGGTGAAGCGGATGGCGGGGAACGAT
GTCTGCTGCGACTGCGGTGCTCCCGGCCCCACATGGCTCT
CCACCAACCTGGGCATCCTGACCTGCATCGAGTGTTCGGG
GATCCACAGAGAGCTGGGCGTCCATTACTCCCGAATCCAG
TCCCTCACACTCGACGTCCTCAGCACCTCCGAGCTCTTGC
TGGCCAAGAACGTGGGGAATGCTGGCTTCAATGAGATCAT
GGAGGCCTGTCTGACGGCAGAAGATGTGATCAAACCGAAT
CCAGCCAGTGACATGCAGGCGAGGAAGGACTTTATCATGG
CCAAATACACAGAGAAACGCTTCGCTCGTAAGAAGTGTCC
AGACGCACTGTCGAAGCTGCACACGCTCTGTGATGCTGTG
AAGGCCCGGGACATTTTCTCTCTCATCCAGGTCTATGCTG
AAGGAGTGGATCTGATGGAGCCCATTCCTCTGGCTAATGG
ACATGAACAAGGTGAGACGGCTCTTCATCTGGCCGTGAGA
CTGGTGGACAGAACTTCCCTACACATCATCGACTTCCTCA
CCCAAAACAGTTTAAACCTGGATAAGCAAACGGCTAAAGG
AAGCACAGCTCTGCATTACTGCTGCCTGACGGACAACAGC
GAGTGTCTCAAACTGCTGCTCAGAGGAAAAGCCTCCATAG
ATATCGCTAATGAAGCTGGAGAGACCCCGTTGGACATCGC
CAGGCGACTCAAACATCTGCAGTGTGAGGAACTGCTGAAC
CAGGCTCTTGCAGGGAAGTTCAATGCTCATGTGCATGTGG
AGTATGAGTGGAGACTTCAGCATGAAGACCTGGACGAGAG
TGATGAAGATCTGGATGAGAAGTCGAGTCCTCACCGGCGG
GATGAGCGGCCCATCAGCTGCTACACACCGGGCAGTAACT
CCCTTCAGCTGAGTCCAGCCAGCCTGAGCCGAGACGGTCG
AGACCTGGTTAAAGACAAGCAACGCTTTGTGCCAAACCTG
GTCAACAATGAAACCTACGGGACCATCATTAACACCAGCT
CACCCGTCAGCCTGTCCTCTTCTGCTCCACCTCTACCACC
CCGAAACCTAGTTCAGCCGTCTGCTCTTGCAGGACTGACT
CAAGGATCTCCCGGCTGGAAGCCTGGCTCTCTGGATCTGA
GCGGCAGACAGAGATCCTCCTCTGACCCTCCCAACATGCA
TCCTCCTGCGCCTCCCTTACGGGTCACTTCCACCTCCCTT
CTAATGCCCAGCGGTGCTGCTCCTCCTCTGGCTAAAGCTA
CTGGTATGATGGAGACCATGAATATGCAACCCAAACCCGG
ACAGGGGCCTCCTGGACAGAACATCAACCGGGCTACAAGT
GCGGACAAAAACTTCAGCAAAAGCACACTGATGCGCTCCG
GATCCATCGAGAGACCAGGTAGATGTCAGAGAAACCATGT
TAACTCTAAAGAAGTCCCAGGAGGCCCACAAAACACCACT
GGTCAAACTCTGCCTGCGACCCACATGCCCAGGAAAACGT
ATTTGAAGCCGAAGCGTGTGAAGGCCATGTATAACTGTGT
GGCCGATAATCCAGACGAGCTGACCTTCTCTGAGGGAGAG
CTTATCGTGGTGGATGGAGAGGAGGACCAGGAGTGGTGGC
TGGGCCACATTGAGGGAGAGCCAATGAGAAGAGGAGCGTT
TCCTGTCACGTTTGTACAGTTCATTATGGACTGAAGCTCG
AGAGATCACACACTGAACTGATGACGGCACTTCTCTGCCT
CTGTGTGGCCTCACTAACCACCACTATCTTCATCATCATC
GTTGTTCTTCCCTTTATGGTGAGGCCTGTATCTTCACCAA
TCTTCCACAAGTCCTGCCTCTGGAGAAATCAGCCTTCTGG
GCAATAAACGCACTTTTGAACTTAATTTATCATGAACACA
ATGCTAATGAATGTCACCAAGATGAAGGTTTTGTTTCAGG
ATCATTCACATCCTTATTTCTTTAGACAGATCTGTGAATA
TAGTCTTATATGCCCACATTCCACATCTGGCAAGGAAAGA
CGGAAGCATAGTAGTGAAATGACAGCCTTTTTGGAGGACT
CTGTTGGATAAGACGGCTCTGTTAATGGTGCTAAAGCAGG
AATATGCTACAGGAGCTGTCTGTCCTAGGAGGAGCGCACT
GATGTCCCCGTTTTCACACTACCTGCCCCAGTGCTGAGTG
CAGAAATAGGTTTTCTCCAGCACTCGCACATGGGAAATCT
CTGAAGTGCACTGTGTGATGGAGAAACTGACAGACTGAAG
AGTGCTTTTGCGCTGGCTGAGGGACGTGAAGATTAAATGA
AAGTAATCTTGACCCTGAAGCTGCTGGGATTTTGGAGCGT
TGTGAATGTTCTCTGGCCTCCAGGGAAAGGAGAGGAAGAG
CATCCAGGAGCTTTTTTTCTGTATAGGTATTTATAAATCG
GAGCTGTTCTGTTTTAGACTCTCGTTGATTTTAACGATCT
TCCGCAGAACTTGCTTCATTGTGCGAGCAATCTGCTGAAT
GATGTCATTTCTTTTTAAAGAGACAGACCAAACCTTCAAA
CTAATTAATTTACTCCAG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
asap2a-201 Contained in:
[BAC] DKEY-27P7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000012671 (1),  Ensembl_Trans:ENSDART00000026152 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CO958833 (1) 847 nt
GenBank:CK689071 (1) 723 nt
GenBank:BG737553 (1) 447 nt
CITATIONS (2)