Transcript

hbae3-001

ID
ZDB-TSCRIPT-090929-22678
Name
hbae3-001
Previous Names
None
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
AB
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000002408 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000002408|OTTDARG00000002230|ZDB-GENE-990706-3 hbae3|OTTDARP00000002135 BUSM1-118J2.11-001 LG_ BX004811.6 Danio rerio protein_coding NOVEL, 594 bp
AGCCCTGCCAAAAAACTGTCAATATTCGAGTTTCTTTTCA
GCCTGCCCACAGCTAACCAAGCAACCATGAGTCTTTCCGC
AAAGGACAAAGCGAACGTCAAGGCCTTCTTTGACAAGGTT
GCACCCAAAGCTGAGGAGATCGGCCGTGAGACTCTTTCCA
GGACTTTGTTCGTTTACCCTCAGACGAAGACATACTTCTC
CCACTGGGCAGACCTAAGCCCCAACTCTCCTCAGGTGAAG
AAGCACGGAACCACGGTGATAAACGGAGTTTTGACTGCCG
TCGGGCTGATGGATGACCTGAAGGGAGGTTTGCTGACCCT
CAGCGAACTACACGCCTTCATGCTGCGCGTGGACCCCGCA
AACTTCAAGATCATCAACCACAATCTGCTGGTGTCTCTGG
CCATGATGTTCCCAGACGACTTCACTCCTGAGGTGCATGT
TTCCGTGGACAAGTTCCTGGCCCAGGTCAGCCTGGCCCTG
TCCGAGAAGTACCGCTAAAGCTGCAGCTTGCCTTCATCTC
TGATGCGACGCTGTATTCGCCTTAATGAGAATGAAAATAA
TAAAATTAATTGAAATTAAATGAAATCAACGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations