ZFIN ID: ZDB-TSCRIPT-090929-22631
Transcript Name: hoxb1bp-001
Previous Names: dZ227H09.4-001, hoxb1b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: pseudogenic transcript
Annotation Status: fragmented
Strain: AB
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000001798 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000001798|OTTDARG00000001684|ZDB-GENEP-090430-1 hoxb1bp|no_translation BUSM1-227H09.4-001 LG_ AL645798.2 Danio rerio unprocessed_pseudogene none, 955 bp
GACATGCTCTTTTCTAAAATGTGTCTGGTTAGACTTGGGT
GACATTATGCTTTAAATGCATCGCGGGGTTTGACAGGCTT
CATCCTTTGAGCTTTATCGCTTAAAGGTCATCTTCCAGCG
GGCCTCCGGAACCACACTGTCACATGACACAAGAGGCCAG
AGTTTTGCTAAACCTCCAGAAAAGACTAACATGATATTGA
AAGCCGTGCAGAAAATGCAGATAAGGAACACTATCGTCTG
TCTCACTGCGTCGCGGAATTATTCGGAGAAGGTAGTTCTA
CATTTGAACTCAAAGAAAAAAATCCTCCCCAAAAATATTG
AGTCAGCGACCGCCAAGGACCAAAATGCAAAGTGATATTT
AATGCAGGACGACAAATAGAAAAAAGAAGAAAAATGGCCA
CAAGATCTGAATCAAGACTTGCATTAACTTCTGCAAACTA
TACCAGAGATAATATCAGATCAACAGGTTTGCAATAGTTT
GTAGTACAAACTGTATACTGGATATATTATTGAATGACAT
AATTCAAGCAAATGCTACAAATAGGAGCGTGGCGTCGTTT
TGTGGTGAGTAAATATAAGCCAATTCAGAAATCCTAAATT
TAGTAAGTTAGAATGCATACCTATTTGATGAAATATTACA
ATTTTGTCATAGTGTTAGATGGGCCTAACTATATACTATT
GTATTCGCTTTTTATTAAAATGTTGATGCAAAGTTTATTT
AAATGTAGAGTAAATAATAACCTCATAACAGCGCAGGAGC
TACAAGAACCCTCCGGCTGGGATTGATTGACTCAAAAAAG
CACATACTGCTGGAAACAACTTACCAAGCATTTGATGCTG
TAAACTTAAAATCTGTTTTCGTAAGTATAAAAAGAGTCTC
TCTTGGTCGGATTATCTCTGCAGCAAACCAAAACTTGCGC
GAAACTTCAACAAAAATGGCATCTACAATGCCTAA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hoxb1bp-001 Contained in:
OTHER hoxb1bp-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000001798 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BQ169342 (1) 624bp
    GenBank:AI794282 (1) 477bp
    CITATIONS (1)