ZFIN ID: ZDB-TSCRIPT-090929-22629
Transcript Name: cacna2d3-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: AB
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000001785 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000001785|OTTDARG00000001671|ZDB-GENE-030616-133 cacna2d3|OTTDARP00000001574 BUSM1-136D19.1-001 LG_ AL713850.6 Danio rerio protein_coding NOVEL, 422 bp
GGTGAAACTCTGGGCTTCAGCGTTTGGTGGTGAAATAAAA
TCAATAGCTTCAAAATACTCAGGATCTCAGCTCTTACAGA
AGAAATACAAGGAGTATGAGAAGTCGGTGCGAATTGAGGA
GATCGACGGCGCAAAATTGGTGAAAAATCTGGCGCAGAAC
ATGGAGGAGATGTTTCGGAAAAAAGCGGAGGCCACACGAA
GGCTCGTCGAAGCGGCAGAAGAAGCTCATCTTCAGCATGA
AGAAAACCCAGACCTACAGTATGAGTATTTCAACGCAGTG
CTGATAAACGAGGTGGATGAGGATGGGAATAGCGTGGAGC
TGGGAGGAGAGTTTCTCCTGGAACCCAACGATCATTTTAA
TAACCTATCCGTCAACCTCAGCCTCAGCGTGGTGCAGGTG
CCAACCAACATGTACAATAAAG

cacna2d3 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA cacna2d3-001 422
cacna2d3-201 (1)    Ensembl 4324
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cacna2d3-001 Contained in:
[PAC] BUSM1-136D19 (1)

Genome Resources: Vega_Trans:OTTDART00000001785 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (1)