Transcript

si:busm1-40g1.35p-001

ID
ZDB-TSCRIPT-090929-22614
Name
si:busm1-40g1.35p-001
Previous Names
None
Transcript Type
pseudogenic transcript
Annotation Status
Associated With Genes
Strain
AB
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000001628 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000001628|OTTDARG00000001517|ZDB-GENEP-030616-479 si:busm1-40g1.35p|no_translation BUSM1-40G1.35-001 LG_ AL591674.3 Danio rerio unprocessed_pseudogene none, 352 bp
ATGCTTCTCCATTAAGTTATTCTGCTCTCTGCTTTAGCAT
GTAAGTGCCAGTAGTGAAGATACTATTACAGCAGACAAAA
CAGAGGAGTTTGCTGATGGTGGTTCAAAAAATGTTACTTT
ATCCTGCACTTTTTCATTTGCATGGTCTATACTTTGGTAC
CGTCAGTATCCTGGATCATCTCCCGAGTTCCTTGTAAACA
TCGCAGAAAGGTCTAAACGAGTAGAGAAGTCTAATGTTGA
TCACCGATTTACTACAAAGATCAGATTAGATAAAGAAAAG
CATGTGGATCTGCTCTTGTCCCCTGCTGCAGTATCAGACT
CTGCTGTGTATTACTGTGCTCTGACGTCCACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations