Transcript

ottdart00000001610

ID
ZDB-TSCRIPT-090929-22608
Name
ottdart00000001610
Previous Names
None
Transcript Type
pseudogenic transcript
Annotation Status
Associated With Genes
Strain
AB
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000001610 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000001610|OTTDARG00000001499|ZDB-GENE-141212-6 si:ch211-96i7.7|no_translation BUSM1-40G1.7-001 LG_ AL591674.3 Danio rerio unprocessed_pseudogene none, 349 bp
ATGACACAGTGGATAAAACTATATATATCGTTCTGTTCAT
GTACATTTGGGGAATAGAGTCGCAGGACAATGTTGAGCAG
AAAGCAAGAGTTCAAACTGCTGTTGAAGGTGAAGCTGTTG
AGATCGACTGCACATATCAAACCCAGCTCACCCCGACTCT
CTTCTGGTACCAGCAAAAGACAAACACAATCCCAAAATAT
ATGCTCAACAGAGTTGGAAAGACTGGAGGTGAAGACAAAG
AATTCAAAGAAAGATTTAGTGCAAATCTCAACACATTTTC
AAAATCAGTTCCTCTGATGATCAGAGATCTACATGTGTCA
GACTCTGCTGTGTATTACTGTGCTCTGCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations