Transcript

ottdart00000001607

ID
ZDB-TSCRIPT-090929-22607
Name
ottdart00000001607
Previous Names
None
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
AB
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000001607 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000001607|OTTDARG00000001496|ZDB-GENE-141212-28 si:ch211-96i7.4|OTTDARP00000001413 BUSM1-40G1.4-001 LG_ AL591674.3 Danio rerio protein_coding NOVEL, 345 bp
ATGAACAAATGCATGCTATTGATTATTCTCATGGCATCAG
ATGTGACGGCTGTGGACAAAATTGAGCCAAACAGTGGGAG
CAAAGTCATCAGAACAGAACGAGAGTCTGTAAAGCTGAGC
TGCTCTTATGATTCAAATAATGAATATGTACGTCTATATT
GGTACAGAAGACATTCAAGTGGAGAACTTCAATATTTATT
ATATGAAGGAGCTCGATCAAACTCAGCCAGAGACACCTCT
GATGCCCGATTTGAGTCAAGTACATCTCGCATATCCACTG
ACCTCATTATTAAGACTGCAGCTCTGTCAGATTCAGCTCT
TTATTACTGTGCTCTAAGAGTTGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations