Transcript

si:busm1-40g1.14-001

ID
ZDB-TSCRIPT-090929-22604
Name
si:busm1-40g1.14-001
Previous Names
None
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
AB
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000001598 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000001598|OTTDARG00000001487|ZDB-GENE-030616-456 si:busm1-40g1.14|OTTDARP00000001405 BUSM1-40G1.14-001 LG_ AL591674.3 Danio rerio protein_coding NOVEL, 344 bp
ATGAACTTTTTGAGGAATTTATTTCTACTTGGACTCTTTT
GTCTTGAGTGCAGATCAGAAGAGAAAGTTGATCAGCCAGA
CAAACACATGACTGAAGTTGAAGGAAAGTCAGTGACGTTA
CGATGTACATTTACAACAACTTCAAACCAACCAGACCTCT
TCTGGTACATCCAGAGAGCAAATGATCATCCCAAATACAT
CCTGAGGAGGGACAAGTATGGAGCTGGAGAAAATGGCACC
GAGTTTCAGGAAAGATTTCACTCTGAACTTTTAACAGATT
CAGTTCCTCTGCTGATCAGAGATCTGCATGTGTCTGATTC
TGCTGTGTATTACTGTGCTCTGAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations