ZFIN ID: ZDB-TSCRIPT-090929-22492
Transcript Name: cep85l-201
Previous Names: cep85l-001, ch211-260o22.2-001, ottdart00000020299, si:ch211-112m17.3-001, si:ch211-260o22.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000020299 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000020299|OTTDARG00000016850|ZDB-GENE-041014-309 cep85l|OTTDARP00000017136 cep85l-001 LG_none AL845301.15,CR926459.7 Danio rerio protein_coding KNOWN, 5780 bp
GTCCGCGTCTCTGGAGGAGATTCTGCGGCCAGTGAGATCA
CATCCTCGCGATGCAGCTGCCAGCGAGTCACAGTGCGAAC
AGCACCGCTTCACAGTAACTCAAATCTGCGACATTTGCGC
CAGCTTTTCAGGAGCTACAGCGTCGCGACACACGGAAACG
CTTCATAAACGCTTATAAAAACGCAGGTTCTTCCAGTCGC
CCATCACTATGGAATGCGGTTTGACTTAAATTCCTCCCCC
TCTACCTTCTTGGTGGGATCGCGCATTTTCTCTCGGTTTT
TTGTGTTGTGTCTGAGGCTTGAGTCACTGAGACCGAGCGC
GATGTGGGCCAGGAACGACTTCGAGGACGGTTTCGACGCT
TATAAGATTGGTTCGAGCACGTCCTCTCCTGGATGGGTCC
CAGGTTGCGACTCGGCATGGCAAGCATCCTCTTCTGCCAC
TGGCATTAGCAGCCGCGGGCGCCGTCATAGTGCCGCCTCA
GACAGTGGTGACACCGGCATCGGGACCTCATGTTCTGACA
GTGTAGAAGATCACTCCAGCTCTAGCGGGACGTTGTCCTT
CCTCCCTCTGCGTCCCCACGGCCCGATCCCGACGGCCCAC
GTCATGCCCTCTCCATCCAACTCCAAACTCAGCGCTCCCT
CTGCACCCAGCAGCCCCTGGAGCAGCAGCTGCCAGCTTCC
CTCACCTCTCGACATCCCCCTGGACATGAAGGATCCCCGT
CCCGTGCGTCGATGGTCCTCCCTCACCCGCCTCACCGCCC
AAGAAAAGCCCTCTCCAACAAACCGTCCTTCCCACCGCAC
GGACCCACATGGATCCCTAGATCGAGGTGTGCTTTACGGA
TACCGGCACGACCCTCAATACTCTGATGGATTTATTTCTG
AAAACTTGCTTAAACTTTCGACCAATAAGTATGACCTGGG
TAGCAGCAACACTTTAGGTAAATCGGACTCATGTTGTTCA
TCTCCCCTGAAGCCGAGTACACTAGACCTCAGTTTTAGTG
CCTTACCAGAGAGTAAGACGCCACCTGTGGGACTGGCAAC
GACGGGACAGAGAGGGTCGTCTTCACTCAGGCAGCAGGCG
GTCGGTGGGTCACCCATCCAGCCAGCGGTCAGGACTCAGA
TGTGGCTGAGTGAGCAGATGGAGTACCGGCCGGGACCTGA
CGGGTGTGGATCATGGCAGCAGGAGCAGCAGCAGCAGAGG
GAGAGACTCAGACAAGACTCTGAACAGATGTTGAGTGGAG
CTTCGCTGCCGGTCAACACTCTGGTCAAGATTAAAGAGGG
ACTCTTGAGACAGAGAGAACTGGAAATTGACCGGCAAAAG
CAGCAGATCCTTCAGCTTCATGCCAGAATCAGGGAAAACG
AGATAAGGGCACAACAAGTCCTCCAGAACCAGAGAGGGCG
CTATGAGGACTCATATCTGCTCAAAGCAAAGGACTCTCCA
TATGACAGTCCGGTGTGCGGCCAGAGCCCGAAGTCTCACC
TGCCGGATCGAGTGAGTCCCCTGTGCTGTGAAAATGGAGA
GCTGGGCCGAAAATTAGCCGCATCAGAGCTGGAGGTCATT
CACCTCAGCGAATTTCTCAAACAAAACACACAGAAATACA
CAGAAGACATCAAGAAACTGGAAGAGAAGATGAAAACACG
TGACCGCTACATCAGCAGTCTGAAGAAGAAATGTCAGCGT
GAACAGGAGCAGAATAAAGAGAAGCAGCAGCGCATTGAGA
CGCTGGAGAAATATCTGGCAGATCTGCCCTCGCTGGATGA
GGTCCAGACACAAGCTCAACAGCTGCAGGACGTGCAGGAG
AAGCAGAAGACGCTGGAGGAAAGCGTGTCTCAGCTGCAGA
AAAGCCTGGAGGAGAAGCAGAGCCTGCTGCTGGAGAAAGA
CGCCCTCATCGAGACTCAATCCAAGAGGGAGAAAGAGCTG
GTGGCTACTGTCCAGAGTCTTCAAGAGAAGGTGGAGAAGT
GTTTGGAGGATGGAGTTCGGCTGCCCATGCTAGACCTGAA
GCAGCTGGAGAGGGAAAACACTCGCCTGCTGGAACAACAG
AGCCACAATAGCCTGCTGATTGACAGTCAGAAGCAGCAGG
TGGACAAGCTCACTCTGGAGATGACGGCTCTGGAGAAGAA
GCTTCAGCGGGAGAGAGGGATCACACAGGAGCTCCGCAAG
CAGCTGTTGGAGCGTGAGGAGGAACTGGACACGCTCTCCA
CCACTCTTAAACAGAAGCACAGACGAGCAGCGGAGGAGAC
GGCACCGATGGCCCTGGGGACGAGTGTGAAGGACGCGGGA
CCCCTGCTAAAGGAGATGTCCCTGTGTCTGCTGGATCTGA
AGGGCTTGTGCAGTGTCCTTACACAGAGAGCTCAAGGCAA
AGAGCCCAACCTCGCTCTGCTGCTCGGTATCAAATCGATG
AGCTGCTCAGCGGAGGAGAGCGAGAAGCCTCTGCTGGAGG
ATGGTCTGCGGGCCAAGCTGGTGGAGGTTTGCCAGCTGAG
GAAAGACATCGACGAGCTACGGACGCTCATCTCAGACCGA
TACGCACAGGACATGGGTGAAAACTGTGTGACTCAATGAC
GTCCAGCGCTCGGAAAGGGGGGAAAAAAAATCACATCAAC
CTGATGGAAACTAAGTCTCTCTGACTGCTGAAGGTTGAAC
CAAGCTGTGAATCCAGTTTACAAGGACGTCTTGTAGTTTG
TGTGTTTTGTTTTTGAATCTTCAAGGATTTTGAATGGAAG
TTGAGTGTTTTTACTGTATTTATTGAGACTGTTGGTTCCT
GTCAGTCGTTTCTGAGGGAAAGAAAAGAAACTGGTGTCTT
TAAGTGCCTTTTGTTCCTGTCCAAACTTCATGAAGTCATT
TTTACCCCTAAAAAAAAAAAGAAGCTGACTAATTCGCTTG
AGGTCGCAGGTCGACGTTCAGGAGCGTCTAGATGGGAAAA
CCATCAACTGAAGGGTCCTCAATCATAAGCACCATCATAA
GAGTTTTGTGTCTGAAGTGTCATTTGAGTGGCTGAACATC
CATTAAAACAAGCATAAAGTGTGTTATTTAAAGGGGCTGT
ATGTAGAATTAACAAACAGCTTGACATTAGCAACACCGAT
GGCCATTAAGTGAACTGCAGCCAGGAACTTATAGTTTGCA
ATTCTATAACCAATCGACCTCAATTTATATTATACATTAA
ATAATAATAATTAATAATATAATCCATATTTTTTGGGGGG
GGACTTTGAATATGCTAATAATGTTCAAGAATTATAGAAA
TTTTGGTAATATATATATATATATATATATATATATAGCC
CAATAAATGTATAGAAAGTTACTCAACTATCACAAGTAAC
TTGGAATTTATTGTTATAACATACAAACAAACGATCAAAA
CTTAATTTATTGGTCGGAGAGAGAGGGGGGGGGGGGGGGG
AAACAGCTGACCTGAAATTTTTAGGGATAACAATACTGAT
ATCTCTGCATTTATTGGCCTATTTATCGGTTTCTAAATGT
AATTACTCAACTATCACAAATAATACATATTTTATTTATT
AAACAAACAAACTACAGGGAAATTACTCAACTATCAGAAA
TAATTATTAATTCACTGGTTGAAGATTAATAAAAAAGAAA
AAACAGCAGATCTGTAATTTTGTGGGGATCAAAATACCGT
TATCTCTAAGTTTAGAAACCAATATATAGTCTAATAAATA
CATAGATAATTACTCAACCATCCAAACTATTTATTAATTT
ATTGGTTTGCGAGAGAGAGAGAAAAAAAACAGCCAATCTG
AAATTTTAGGGAAAATGATACCAATATTTCCCTATTTAGC
AACCGATATATACAATCAACAACATACAAACAACAGGAAA
GTTACTCAACTATCAAAGCTAATTAATTAATTGGAGACAT
AAAAAAAAAAAAAGAGAACAGACCATCTGGAATTGAGGAT
AACTACCGATATCTCCACATTTAGAAACCAATATATAGGC
CAATAAATGCATAGAAAAAGGACTCAACTGTCACATATAA
TTCACTAGTTAAGCATACAAACAAGAGGGAAATTACTCAA
CTATCAGAACTAATTAATTTATTGGTTGAAGAAAAAAAAA
AAAAAAAACAGCTGGTCTGGAATTTTGGGGATAACAACAC
TGATATCTCCACATTTAAAAAACAATATATAGGCCAATAA
ATGCATAGAAAAATGACTCCTCTATCACAATTTGTAATTT
ACTAGTTAAACATACAAACAAAAGAGAAATTACTCAACTA
TCGGAACTAATTATTAATGTATTGGTTGGAGAGAGCTGAT
CGGGAATTTTTGGGGATAACAATACTGATATATTCACATT
TACAAACCAATATATAGACCAATAAATGCATAGGGAATTA
TTTAACCATCACAAATAATTCATAATTTATTTAATTGTTT
GTTTGTTCAAATTTGGCTAATAACTTTAACAATGAACATG
TCAGCAGATACCAATATAGCTGCCGATATACATTGACCAT
CCAGGATGTAGTTAGAGATGCACAAAGTCTAAAATGACAG
CAAATTTTGCTCAACCGGTGTAAATATCCATAATTTATTG
GTTTAAGTACCATGACAATACATTTAATTGGGGAAACAAG
CATTTATCAGTTGATAAAACATCACCCTGAGGGAGAATAA
ATCCCTTTATTCATGATCCCTTTAAGTTGTTACAAGCTTC
CATTAAACGTCGCAATAAATAAAGAGATGAATGTATAACA
ATTCATACATACAGCCTCTTTAATAACAAACAACAGCAGA
GTAAGTAATCCAGGTCAATCTATTCAGGACACCGTTTGAC
TTTTTAATTTGAAAAAATACCAGCTGCTTTTTTTGCAGAA
CAAGTTGCACACGTTAAACTCCAAAGTCAGACAGGAAACG
GAATGTTCTGCACTTCCTGAAAGCGCTTATGACATTTTAT
ATACTCCATATAACACATGTATTCCTTACTAGAATTAGGA
AAACGAGCGAAATCAATGCAAAACTTGTTCACTCAGGTAT
TTTTAGCGTTTCTTTTATTCGTTGTGGTCGTAGTGACTAG
ACTTTAGTAAGTGTCATTCAGACCCTGAGCTTAAACTGTT
TTTGTCGTAGTTCAGAGATGCGGTCATGTCAAACTTTGCA
CCAGTGACGAATGTTTAAAACTATGTAAAAGTACAAACAT
CTATATTCTGCTTCTATATCGTAACTATTTCAAATATATT
ACGCATGTTTTGTTATAATATCTGGTGCATGTGCATAGAG
TTTGGTTTATTTTCTTTGAATTTAACGAAGATAATTACAT
TAGACGTATACAGCGCTATGCAACCTCACGTTAACCAGCG
TTTCTGCAGATCTTTCATGTTATTTTGTGCCTTTACGAGT
CTATGCAGCAGAAGCTGAAGAGAGTTTTATTTCTAAATAA
CAGGCGGAGAAGTTTGTTTCTTAAAGATGCAGGCGAACGA
AGCCATATTCACAAAGCAATGCATATTTATTCTCAGGCAG
AGAGATGTGTGTTTATGTATGTGGTGCTCGCCATAACACC
AATCTGACAGACAGCATGCTGAATTGTGTGTATATATGCA
GGAGTATATAAGCATGGATTGACATGACCGAGTCGCTGCG
CTTTAAAGCCACTGGTTGGCTCAAGTGTTTCTCTTTTAAA
GCTTTTAAGTTTCCAGCTAGATTTTACACATGCCAAAGGT
CTATTTATGTACAATGGGGTTTTCTCAAAAGTATTAACTA
TTTTTCCATTTTGTAAAATGCTTTTCATTTGTACAAATGT
CAAATAAAGTATTTTTCTAC

cep85l TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA cep85l-201 5780
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cep85l-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000020299 (1),  Ensembl_Trans:ENSDART00000061141 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CR929553 (1) 539 nt
GenBank:AL917846 (1) 370 nt
CITATIONS (2)