Transcript

jph3-201

ID
ZDB-TSCRIPT-090929-2249
Name
jph3-201
Previous Names
  • jph3-001
  • si:ch211-255l14.9-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000012587 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000012587|OTTDARG00000010859|ZDB-GENE-060503-415 jph3|OTTDARP00000010805 CH211-255L14.9-001 LG_none AL929464.10,AL928934.7 Danio rerio protein_coding NOVEL, 3839 bp
ATGTCCACTGGGGGCAGGTTCAACTTTGATGATGGGGGAT
CATACTGTGGAGGGTGGGAAGAGGGAAAGGCCCATGGCCA
TGGCATCTGCACAGGACCCAAGGGCCAAGGCGAGTATGCG
GGCTCCTGGAGTCACGGTTTTGAGGTGGTCGGTATCTATA
CCTGGCCCAGTGGGAACACTTTTCAGGGGACATGGGCACA
AGGCAAGCGGCATGGCATTGGAATTGAAAACAAGGGCAAG
TGGGTTTATAAGGGTGAGTGGACACATGGATTTAAGGGAC
GCTATGGTGTGCGGGAAAGCACAGGAACCAGCGGCAAGTA
TGAGGGCACGTGGAACAACGGCCTACAGGATGGATATGGA
ACAGAGACATACTCTGATGGAGGTACATACCAGGGCCAAT
GGGTGGGCGGCATGCGGCATGGATACGGTGTGCGGCAAAG
CGTTCCGTACGGCATGGCGGCCGTCATCCGTTCACCTTTG
CGTACCTCCATAAACTCTCTACGCTCCGAGCACAGCAATG
GCACAGCTCTGCTGACCGGCGATCGGGCGCCTGTGGCTGG
TGTAGGAGGCAGCGGTGTCCTAGTAGTGGGCAGTCCAGCA
GTGTCCCGCGGAGGCTTCGTTTTGACAGCCCACAGCGAGG
CAGAGCTGTTGAAGAACAAAAAGAAGGGCCTGTTCCGTCG
CTCACTCCTAAGTGGTCTCAAGCTGCGAAAATCAGAGTCC
AAGAGCTCGTTAGCCAGCCAGAGGAGCAAGCAGAGTTCCT
TCCGCAGCGAGGCCGGAATGAGTACGGTGAGCTCTGCAGC
ATCCGATATCAACTCAACCATCAGCCTAGGTGAAGGAGAA
GGTGAGCTGCCGGTGGGCGACGATGACGTAGATGCCACTA
CCACTGAAAGTTATGCTGGCGAATGGAAGAACGACAAGAG
GACAGGCTGCGGGGTGAGCCGGCGTTCTGACGGACTGCAG
TACCAGGGCGAGTGGTTGGGCAACAAGAGGCATGGCTATG
GATGCACAACCTTTCCCGATGGTACCAAAGAGGAGGGCAA
ATACAAACAGAACATACTTGTCAGCGGAAAACGGAAGAAC
CTTATCCCGCTACGTGCAAGCAAGATCCGCGAGAAAGTGG
ACAGGGCGGTCGAATCGGCAGACAAAGCTGCCGACATCGC
AAAGCAGAAGGCAGAGATTGCACTCTCAAGGACAGCTCAC
GCAAGAGGGAAAGCCGACGCCGCAACAGCAGCAGCGCAGA
AAGCCCAGGAAGAGTGCAGGTTGGCCCGGATCACCGCCAA
AGAGTTCTCCCCCTCTTTCCAGCACAGAGGAAACAGAGTG
GAGTGCCAGCGACCCAAACAGCAGAACTCGAGTGAGAACG
ACGTGGAAGTTATATCTAGTGGGACTGCAGACAGCACTGA
ACTCTATATGAAAGGCTCCACACCTCCGGATCTAACCCCG
GATGTGAGTCCCACTCCCAGTCGGCCCTCTACGCCTCCAC
GTAGCCCGACCACCAAATCTTCCCACCGCACCAAAAATGC
CCGCTTCTTGCGACAGACTGCAGTGGATGAGGAGCGTGGG
GGAACACAAGAGATCCAGGTGCTGATGGAAGGGAGAGGTG
GAGGTGGTGGTGGTGGTTCAGGTGGAGGTGGAGATTACCT
GAGGGCTAACAGCTGGAGTGAGGAAAAGCGTCCCTCCCGT
GGGGGGAGCAGTAGAGGTGGTAGTCGGGGTAGCAGCCGCT
CTACAACCCCTTCAGTACAGGACGAGGTACGGGTCGGAGC
GGCACGGGCCAATGGCCACAAGCACTCTTCTAATCATAAG
CCTCGAGACCACAGTTCCTCCAATCACAAAACCCCAAGGG
AAAGACGGCCAGATGGACCTTCGGCTTCCTGGACGTCTCA
GCGGGTACATGGGGACAGTTTGGCTCACTCCCGTCTCCTT
GAGCAGGATGAGGAAAAACTGAGCAATTATGAAATGGAGA
TGAGGCCGTTACAGCCAATGGACTCCCATAACTCCCAGAA
GCCCTATGGGCATGGGGAGGAGCGGCATGGTCACTCAGAG
ACCCGTGCACATATGTTACAGCAACGGGGCAAGAACCGTG
ATCGGGAGCGGGATGTCCGGGATGCTTCGGGTCACAGGGA
CACCCGGGAGGGGCCAGCTTTGGACTCAGTGCAAAAATTG
GACAGCCTACGAGTGGGGGAAAAGCTAGAGGCTCGGCCCC
TCCGCAGGGACCTAACACTCTCACCCCCACAGAAATCCCC
ACCTATTGCACTAGAGCACGATGACGAGAATCAGTCTCAG
CTCAAAGTGAACTCGGGCTCCAACTCGATTCTGGTAGTCA
TGGTGATTTTGCTCAACATTGGAGTCGCCATTTTGTTTGT
TCATTTTTTTATTTGAACTCTGCATCGCCTATCAGTTCCT
CTTCTCTGACTACACTATTACCGAAGTGTCATCACAACCG
ATCTGGTCCCGGCTCGTATTTTTTTAAAACAAAGACCACT
GTACTTCCATTGAAGTTACAGCATGTCAACAGGAGGTCTG
AGGAAGGCAACAACACAAAAACTGGGCTCAGCGGTTCCGT
CTGCTTTTCTGTCTCCAAAGAGCTCATGTTGGTTTCTTAA
TTTGATTTTCTTTTCTAAATCTGAAATAGTTACAAGCATC
CTTTTGAACTTCTAGTTTTATCCTATGTATTCACTCACTC
ATTGATGCTGTTATGAATTGATATACTTGTTTCTCTTTTG
TTTTCTTTCATATTCCTTACTTGCCTTTTTCTTGATGATG
CTGGTGGCTTTTGTTTGTTTCCTTTGGGTTTGGTTTGTAT
TTGGGCGTTGGACTCATTTGAATGGTGGCTTTGGTGAGGG
AGGGTGTGCAAGGTGGCGTAAGGGTGAAGGGCGACCACCA
TCAACATCCTTTCGGGTGACGGCAGCCTTACACAGCTATG
ATGTCAACAAGGTTCAAAGTGATGGGAAACGGCCCCTGTC
TAACCCCACCCGCCTCCCTCGCGCACCACTCCAAAGCATT
GCTTATGTTTCTTCATGTCCTTGTTTTTGTCACCCATCAG
AATAACCCACCAAGCGCTCCTATCATTACACCTCCATCTA
CCTTCTGTGTGGTACGTCAAATACCAGTGGACCCCAGAAT
GTCATGGTGGGCCTGAATTGAGACACTTTAACTCCATTGG
ACCTAAAATAAGGGGCAAAGCTTTTTGTTGTCGACACACC
TTTGAATTCGCCTAAAAATGTTGCACATGTCGAAAAGAAA
TGGGCTTAACAAGCACAACCACACCAAAGTGGGTTAGTAA
AAGTTCTGGTAATCACAGAAACACAGCGCCACCAGCGTTT
CAGCATCTGCAACATTTGCACTCAGGCGAATCTGACCCAC
ATGCATTTGGAAAAATTCCCAGATTCAGAAGTTCTAAGAT
CTGAAAGGGCTTCATCATTAATCTTGCTCCAAATGAAACT
TTTTTTTTTCCTACCGAATAAATCATAACACAGTTCGACT
TATTTATCTTTTCATAAACGGGTTCTGCATGTAAGATTAT
ATACTGTACATTCAATACAACGTAGCATGGGTTGCACTTT
CCTTTGAGCATTTTATGTTCTTTAAACATTCTTTAAATGT
TGTATGAGGGCTAGCACATGACATTCTGTGAGGTCATCAT
CATTATGAACTTCTTAAAGACCGCCCCCTACTCTCTTTGA
TGAAATCACAAGAATGTGCGAGCTCCTGCCAACCTCACCA
TGCACACCTGAAAGCCACATGCTGCGCGAGATGCTGGCGT
TCCCGACCAGACATTCAAGAGACTGTTAACGTTTTTTTCC
CAACTGCTGCTTTCGAAAAACAAATATTTATTGATAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations