ZFIN ID: ZDB-TSCRIPT-090929-2247
Transcript Name: zcchc14-202
Previous Names: zcchc14-001, si:ch211-255l14.7-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000012584 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000012584|OTTDARG00000010857|ZDB-GENE-060503-319 zcchc14|OTTDARP00000010802 CH211-255L14.7-001 LG_ AL929464.10 Danio rerio protein_coding NOVEL, 4174 bp
GCCTCGTGTCTAAAACGGAGTTATGAGTGAACGTCAAGTT
AATGCGCTCTATCGCTTTAAATAATACAATATTTTACTGT
CCACATCAAATATGACTGCATGCGCTTGAGAGATTTGCAA
GAATCGCGCTTCGGCCAATCACAGAGAAGAATAAGATTAC
TGACATACTGCTTATCCAATAGAAATCGGCCGGGGGCTGG
GTTTTGCATGAAGTTCGGGATAGTGAACTTCACAGTTTGC
CTGCTCGACTTCACGACAGGATAATGATTGGCAACTAAAT
CGTTGATTAATTCACTCCCGTGAACTGCAAATAAAAGCTG
CGGATAAAGTGTCAAGTTTTTCTTTGAATGACGCAAACCG
CTTCTTCAGCGTCCGACGAAGGGATTTAGAGTTATACTGC
GGTCCATTCGACAAGTCAAACTGTTCAATTTGAGGAGTTT
TCCACACAAAATGTTTATTGTCCGACGGCGTCTCCTCTGC
GCGTGCACGGCAGTGTCATTGATTTCATCTGGACAAATCG
GTCTAATGGATACTGTATGATCTGAAAGAAAGGTGCTTGT
TTTATAATGTGTCCTGGAGTCTATTGAATAACTGGCTGAC
GTGGGGATCACGCAGGGGGGCTGGCCGAAAAAGGAGAGCC
ACGGACGGGCAGAGGGGCTGCGCCGCCGTGCGTCTGGGAT
TACAGTAAACACAGCTGGTTTCTTCAATAACCTGATAGGC
TCTGATGAGAAAATGCAATCACTAGCTTACAAAACGCGAA
GGAAACTATGTAGCAAATATTCATGTAGGGGTTTTGAGAC
GCTCAGACTGACCACTGTCCATAAAGTTCATGGATGTTTA
CCTCAGTGAATGATCTGGAAGTTTGTAAAGTTTGAAAGGG
CCACAGACCACTGCTCTATTAACTTTGTTTTTTATTATCT
GACGCCTTTTAAGAGTGCTGTCTAAGATGGTTGAGAACCG
ATGCTTTGTTCAGAGAGAGGAGGTTTACCGCTGGTTCTCC
GTGTTGAGTTCGGCGCAAAGGGCTGAGTTTCTCTGCGGCC
TTTTAGACCTCTGCGTTCCCATTGAGCTGCGCTTCCTCGG
CTCGTGTTTGGAAGACCTGGCCAGAAAAGACTACCACTCA
TTGAGGGATGCCGAAATTAAAGCCAACAACCCGGCTGACC
TCGCCAACCTGGCCAACATCACGGATGAGGTGGTTAGGAG
CAAGCTGCTGGTCTCCCTCGCGCTGCTCAGCTCGGACAAC
CGCGTCGCGGCGGGAGTTTTGTTTCGGACCCTCACTCACA
TCGACACCATCATTAACAACTACGGACTTAAGCTTAACGA
TGGCCAGACCGGAGAGCAGTTTTTACTCCTCTTCACAATG
GCCTCCAATCATCCCGCGTTTAGTTTTCATCAGAAGCAGG
TGCTGAGGCAAGAGTTGACACAGATTCAGGAGATCCTTCA
GGTGACAGTTGGAGAGGCGCCGTCGACGTCACACGGGGGC
GGGGCCAGTGCTGCTTCTGTTCCAACCGTGAGCGCGACCC
CGACCTTTTCTTCCTACATCACTGCATCCACTTTCAACTC
CTGCCAGGCCGGATGTCCGTGCAGTAAGACTGGGCAGCGT
GAGGCCACAGGAAGTCAGAAGGATGACAGTTTGAGTCCTG
AGATCATGCCACCAAGTCCATCGCTCTTGTGCCAGGAAAT
GCCCCTTAAAGTACATGTCGGAAAACCCAGCAAAGTGTAT
GTTGAAAGAATTGAACTAAGAGGAGTTACATCCAAATCAG
ACAAGTCAGCCGAATACATCCTGGAGGCCTTATGGTCTGA
CTCTACTTTGTCGACTGTCAGCAAAACCCCTCAGGAAGTA
ACGGATTTGATCTCTCAGCTCTCTCCGCTCTTTCCCGATG
AATGTCTGGAGAAGCTTCTGCCTCAGATGCCTGGACTTGA
TTCCACTCATGAACTAGATCCACGATGCTTGACCTCACTT
CCGCCTCAAGTTCTCAAACATGATAAAGTCCGTTTCTTCT
TCAGCACTTCATCCGCACCACAGCTTCCAGCCAGCACAAA
TCTGAGCTGTTTGCTTCAGTATAGAGGAGCTAGTCGGCCT
ATTTGTGGTGTGGCCAGCATCCAGCCTGTCCTGAGCATCC
ACACACCCCTTCAGCAGAGCTCTCCTTCCCACCTGCCACC
TCTCCCTCCACAGACAGCAGTCACCATCCTCCCTGGTGCT
CCTGTGCCCATCAATGATGCCAATTCACCACAGACGCACC
TCTCTAACCCTGCGGCCCAACCACAACAGCCTAGTCCAGA
GCAGAACGGCATCCTGGACTGGCTCCGCAAACTGCGCTTG
CACAAATACTACCCTGTCTTCAAACAGCTCACTATGGAAG
AGTTCCTCGCGCTCACAGAAGAGGATCTCAACAAATACGA
CCTCACTCAGGGGGCCAAGAAGAAACTAAAGACTCAGCTG
GAGCTTCAGAAAGAAAAGCTGGAGAAGAGATATGTAGTTT
CTCAGTTTCCTGTTTCCTGTGGTGGGGTTGCGAGAGTGAT
GCCTTCCAGTCACATCGGACCCCTGACACACGCACACCCT
GGAAGTGGCAGCGAGCTACGGGTAGATGTGGAAAACAGCT
CGTTACCTATTCCACGGGACAGCAGTTCCTCCTCAGGCTA
TTCCAGTGCTCCTTCCAGTCCAATGACCCCTTTATCACGT
GACACTTCCTTTGACCGGGTTAAAGATCCTCACAGACGTT
TGGAGTCTGGTATGGATTCTGGAGAGAAAGAGAGGTCATG
CTTTCTCCTCAATCCTGCTGGTCCTAGCCGCCCCACTGCC
CAAGTCCTTCCAGTCCAGAATGATCCCCTGCTGTGTGCCT
CCCAAATGAGTTTACCTCCTCCCTCTCTTCCCCTCCTCTC
TCCAGGCCGAGTTCTCAACTGTCCTCGGAAACCTCGTCCA
CCCCCATTATGTCCAGAAGAACGTCCCAAACCAGTGGGTT
CCGGGGTTCCTGTGGGTGTCCGGCTCGAGAACATCTTCCC
TGGGTTGAATCTTGATGGTTCTCAGGGGCATCAAGATGTC
CCTGGCCCCAGAGGGCCGCTTACTGTGCTCCGTTCCCCTC
CAGGTCTCATGGTGGAGACCAGCACTTCTCTCACTTCCAC
ATCTAACACTCTCCACCACGTCTCCCACCCACCCTTACAC
CTACAAGTGTCTTCTTCTGTTCCACGTACAGGATCCTACC
TGTTCTCCACCCCTTCCTCCTGTCTGTCATCAAGTTCCTC
CACCAGACCCTCCTTCTCATCTGTTAGTGGAGTACCAATA
GCAACGGCTAACAGTGTTCCCATGGCAGCGGTACCCGGCC
ACACCTACTGTGTAAACAATACACCCACAATTACGCCCTG
TTCTAGCCCAGCCTCCACAGAGAATAGCAGCTACGTCTCG
GTGCAAGCGAACAGTGCTAACTCCAGTTCCTCTTTGTGCG
TATGTAGCTCGTGTGGTTGTAGCGGCAACTGTGGCTCCTA
TGGGGCACTTCCGGCAAGCTACACCGGCTACTTTCCACAT
CCCTTTTCAGGAACGTCAGTATTCACTTTAGGTCCATTGC
TTCATTTTAGTCCACTCCTTACAGGAAGCGGTACCGCCTC
TCCTTTTTCATACCCTTTGGTGGCCCCGCCTATTTACAAC
AACAGCCTATCACATGACTCACAACAGAATCTTGTGCTTC
CGCCAGTGCAGGGTTTTCTTGGGGGAGGGGGCGCTGTCTA
CCAGCCCCATGGAATGATGGGAAACGGAAGCACCGGACAT
AAGAAAACAGGGAATGTGTCTTGCTATAACTGTGGGCTGA
GTGGGCATCATGCACAAGACTGTAAGCAGCCAGCCATGGA
CTCTGCACAACAAGGGACGTTTCGCCTGAAATACTCTCCT
CAGTCAGAGAGTCAGGACTCAGGGGACTAACTGATGTGTA
AGAACTGGTTTGGACCTGCACCTTCCTCAGTGTGTGAAAA
CACTTGACGTGAGATGCCGCTGAGCAAAGATGTTACAGTA
TCACTTTAGAGGAGCATCGACTGATCAAGTTTGATGAGTT
GCATCGTTGAAAACCTCATGCCAAAAAAAAAATCACCTCA
CAGTGGATCTTTGTAAAGGGATGCTCAAAGAAGAATGCAC
TTTTTTTGTGTTTTTCATGCTGTTCGCCTCATCAGTCAAC
ATTTGGAACACTTG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zcchc14-202 Contained in:
[BAC] CH211-255L14 (1)

Genome Resources: Vega_Trans:OTTDART00000012584 (1),  Ensembl_Trans:ENSDART00000162463 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CD595167 (1) 647 nt
CITATIONS (2)