Transcript

si:dkeyp-35f12.3-001

ID
ZDB-TSCRIPT-090929-22469
Name
si:dkeyp-35f12.3-001
Previous Names
None
Transcript Type
mRNA
Annotation Status
Withdrawn by Sanger
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
None
RNACentral
Note
None
Sequence
OTTDART00000042789 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042789|OTTDARG00000030805|ZDB-GENE-090313-385 si:dkeyp-35f12.3|OTTDARP00000033969 DKEYP-35F12.3-001 LG_ BX294128.19 Danio rerio protein_coding PUTATIVE, 524 bp
CAGAATCACGTGTGGGTGGACGTCACTCGGCACAACTCAA
ATCTGCCCCCGCTGGCGGTCAAGAACCCAGAATGCCTTGG
TTTGCTCCATCAGCTGGACAGAAGCAAAGACTCATGGGTG
CAGTACTACTGCGTGCTGAAAGACGGATGCCTCTATTTCT
ACGTCAGTATTCGTTCAACATCCGCCATAGGAGGAATCTA
TCTACATGGATACACAGTGAAAGATCAGCCGCTGGGGTCC
AGAAGATCCACCATTGAGCTCAGGCCTCCGTCTGATGAGT
TTAAAGTCTTCTACCTCTGTGCCGAAAATGGAAACGAGAA
CAAACGATGGATCAGTGCTATTAAATCCTCTATAACAAAA
TGGCTGCCACTGCATCAAGCAATTCAAGACTACATGAGTC
GGCCAGCCGAGGAAACGAGAATGTGAACAAGACTGACCTC
GATTCTGCCAGCGTTGATGACATGATGGTGAAGATCCTAT
GCCTTACAGACAAATCATACTACTGCGTTTCAAATCAGCT
GGAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations