header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-22317
Transcript Name: si:dkey-161p7.6-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000042618 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000042618|OTTDARG00000030713|ZDB-GENE-090313-195 si:dkey-161p7.6|no_translation DKEY-161P7.6-001 LG_ BX927365.7 Danio rerio processed_transcript NOVEL, 587 bp
GGCCTATAAAGCTTTGTAAATCCTGTCCCGGTAAAGCTCT
GTGCGGCCTGAAGCTGGAACTCCGGATGTCAAAGTCAACT
GTACTGGATGTTCACTGATGCTAAAGGGAATCGATGAGTC
ATCCTGCTGGACCTCTACCGCAGCTGACATCCATGTCTGA
TGAAAAGAGCGACAAAACTATTGTTGTGAGCCTCCTCATA
TACTTACAACTGACTCAGAAGGACAATCAGATAATGCGTC
TCTTCATCTTTACATCTTTAACATTGGAAAATCGATTCTC
TCCATCATCATCATCATTATCATCCTCCTTCCCCTTTCTC
CGCCATCCAAGATGACGAACCTGTTGACTCATTCACCCCT
TTGCTCATTCACAACCAATGCTTGACCAAGAGAAACGCGG
ACAGGTATAGGAGAAACACAGAGCGTGAGTCAGACGAGCA
CTGCAGCGGTTCCTCCGAGAGCACTAAAACACACCCATCC
AATCCATCAGCCTTCATTCATCCTTCGCCTCATCCTTCCA
TTCACACAATCAGAGCGGCGGAGAGGAGGAGGAGGAGGGA
GTGAGAGAGGGAGAGAGACGCTGCGAT

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-161p7.6-001 Contained in:
[BAC] DKEY-161P7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000042618 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CD596245 (1) 650 bp
CITATIONS (1)